Annals of Surgical Oncology Cite Track
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/s10434-006-9115-8
Annals of Surgical Oncology 13:1747-1753 (2006)
© 2006 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choudry, H. A.
Right arrow Articles by Pan, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choudry, H. A.
Right arrow Articles by Pan, M.

Original Article

Stimulation of Expression of the Intestinal Glutamine Transporter ATB0 in Tumor-Bearing Rats

Haroon A. Choudry, MD, Wiley W. Souba, MD, ScD, ChengMao Lin, PhD, QingHe Meng, MD, Anne M. Karinch, PhD, Jingli Huang and Ming Pan, MD, PhD

Department of Surgery, The Milton S. Hershey Medical Center, The Pennsylvania State University, College of Medicine, 500 University Drive, P.O. Box MC 850, Hershey, PA 17033, USA

Correspondence: Address correspondence and reprint requests to: Ming Pan, MD, PhD; E-mail: mpan{at}psu.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Background: Glutamine supplementation ameliorates host catabolic response in tumor bearing states. The purpose of this in vivo study was to investigate intestinal glutamine transport and expression of glutamine transporter ATB0 in methyl-cholanthrene (MCA)-sarcoma bearing rats.

Methods: Fisher-344 rats underwent subcutaneous flank implantation of MCA-sarcoma cells (saline as control) and were pair-fed an equal quantity of chow as controls, to account for tumor-induced anorexia, until tumors reached 10 or 20% body weight. Intestinal mucosal brush border membrane [3H]-Glutamine transport was measured. Glutamine transporter ATB0 mRNA and protein levels were measured by real-time PCR and western blot techniques, respectively.

Results: Glutamine transport activity across the intestinal brush border membrane (BBM) was 3.7-fold higher in tumor-bearing rats (TBR) than in controls (TBR 153 ± 22.6 vs. Control 41.9 ± 9.7 pmol/mg protein/10s, P < .01). Transporter ATB0 mRNA levels were 1.4-fold higher in tumor-bearing rats (Relative value TBR .61 ± .12 vs. Control .43 ± .1, P < .05). A 1.4-fold increase in transporter ATB0 protein levels was observed in the tumor-bearing rats (Relative value TBR .52 ± .07 vs. Control .37 ± .04, P < .05). Circulating aortic plasma glutamine levels were 1.3-fold higher in tumor bearing rats ([Glutamine] = .63 ± .02 Control vs. [Glutamine] = .74 ± .01 mmol/l TBR, P < .0001). Portal venous plasma glutamine levels were also higher in tumor bearing rats ([Glutamine] = .47 ± .01 Control vs. [Glutamine] = .60 ± .02 mmol/l TBR, P < .0001).

Conclusion: Intestinal brush border membrane glutamine transport activity, transporter ATB0 mRNA and protein levels are up-regulate in tumor-bearing rats.

Key Words: Glutamine • Methyl-cholanthrene sarcoma • Tumor-bearing rat • ATB0


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Glutamine is the most abundant amino acid in the body and major fuel consumed by various tissues and organs. Glutamine is a conditionally essential amino acid such that exogenous glutamine supplementation is often required to maintain the host glutamine homeostasis when increased demand for glutamine exceeds the body’s capability to synthesize it.

The roles glutamine plays in tumor states are still quite controversial. On one hand, glutamine is the major respiratory fuel for a number of tumors.1,2 Tumors have been shown to alter inter-organ glutamine flow, acting as "glutamine traps." 3,4 Tumor glutaminase expression and activity correlates with its growth and differentiation.5–7 On the other hand, glutamine slows the host catabolic state that is associated with progressive glutamine depletion. This is especially pronounced in skeletal muscle where glutamine depletion has been shown to directly correlate with decreased skeletal muscle protein synthesis and increased muscle protein degradation, thereby, favoring cancer cachexia.4,8,9

There is considerable controversy in the literature regarding nutritional supplementation in patients with cancer due to the potential for feeding the tumor. Most studies clearly show that with TPN-supplementation tumor grows but the host does not. This has been demonstrated in different tumor models including malnourished gastric cancer patients and methylcholanthrene sarcoma tumor model among others.10,11 A few studies show that they both grow equally12 but no studies show that the host grows faster. At the same time, in vivo experiments in tumor bearing rats have shown that the provision of glutamine-enriched total parenteral nutrition (TPN) or enteral nutrition (EN) failed to stimulate tumor growth, yet muscle glutamine concentration increased and gut mucosal glutathione content increased, potentially favoring the host.2,7,13–17 Studies have also shown that preventing tumor glutamine metabolism using the antimetabolite acivicin arrests tumor growth.18,19

Dietary supplementation of glutamine could have the beneficial effect of restoring the levels of glutathione inside natural killer cells,3,13,20,21 repletion of intracellular muscle glutamine concentration4,8,9 and maintenance of intestinal mucosal barrier function to prevent gut-derived bacterial translocation and sepsis.22–24

The small intestine is the predominant organ for exogenous glutamine entry into the host. Luminal glutamine absorption across the intestinal brush border membrane occurs predominantly (80–90%) via the unique, epithelial sodium-dependent, neutral amino acid transport system B (ATB0) and partially by the ubiquitous sodium-independent, neutral amino acid transport system L. System L is the principle carrier for neutral amino acids at the baso-lateral membrane.25

The methylcholanthrene-induced sarcoma (MCA-sarcoma) model has probably been most extensively utilized to investigate inter-organ glutamine metabolism. This tumor grows most effectively in the Fisher 344 rat and is locally aggressive but rarely metastasizes, causing death in 5–6 weeks at which time tumor size accounts for nearly half of total body weight.15 With tumor growth, intestinal extraction of circulating glutamine across the basolateral membrane is diminished in the tumor-bearing rat, whereas, uptake from the lumen is increased. Salloum and colleagues found that rate of glutamine uptake by brush border membrane vesicles (BBMV) in tumor-bearing rats (TBR) was significantly greater than controls, regardless of tumor size. This was due to increased maximum transport capacity, not transport affinity and was specific to glutamine.26

A better understanding of intestinal glutamine transport at the molecular level may help further understand the mechanisms and mediators involved and direct therapeutic potential of glutamine in dietary supplementation. The purpose of this in-vivo study was to investigate glutamine transport and expression of the intestinal glutamine transporter (ATB0) at the molecular level in MCA-sarcoma bearing rats.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 
Animal Model
The animal protocol in this study was approved by The Pennsylvania State University College of Medicine Institutional Animal Care and Use Committee. Male Fisher 344 rats weighing 150—200 g were used for the experiments. The animals were fed with standard laboratory rat chow and water ad libitum and subjected to alternate 12 h periods of dark and light. The rats underwent subcutaneous flank implantation of 2 x 2 x 2 mm3 (2 x 106) viable methyl-cholanthrene-induced fibrosarcoma cells. Control rats underwent sham implantation of saline. Following tumor-cell inoculation, control and study rats were pair-fed. The daily ration of the pair-fed non-tumor bearing rat was the same as the amount of food consumed by the tumor-bearing paired rat on the preceding day. Once the tumor reached an average of 10 or 20% body weight, the tumor-bearing rats were sacrificed. These time points were selected because cancer cachexia becomes apparent once the tumor grows beyond 15% body weight. Therefore, for analysis, the data was divided into two groups; tumor weight less than 15% (average weight 10%) and greater than 15% (average weight 20%). The paired controls were sacrificed the following day to account for pair feeding. All studies were conducted after overnight fasting of the animals.

Preparation of Rat Jejunal Brush Border Membrane Vesicles (BBMVs)
Jejunal BBMVs were isolated using Mg2+ aggregation/differential centrifugation techniques.26 Briefly, jejunum was removed and rinsed with ice-cold phosphate buffer solution (PBS) to remove luminal debris. The jejunal mucosa was then scraped off the intestine and homogenized, using polytron (setting #6 for 30 s), in buffer (300 mmol/l mannitol and 1 mmol/ l HEPES/Tris, pH 7.5). Small amount of homogenate was saved for BBMV enzyme enrichment comparison. Magnesium chloride (MgCl2) was added to homogenate to a final concentration of 10 mmol/l. Basolateral membrane and intracellular components, bound to MgCl2, were separated from BBMVs by differential centrifugation at 35,000g for 20 min. The BBMVs were purified with repeat centrifugations and diluted to a final protein concentration of 10 mg/ml. The final BBMVs were purified ~10-fold over homogenate, as indicated by enrichment of marker BBMV enzyme alkaline phosphatase. Vesicles were kept in liquid nitrogen. Protein concentration was determined by BioRad protein kit (Hercules, CA).

Glutamine Transport Measurements in BBMVs
[3H]-Glutamine (0–1 mmol/l) transport in purified BBMVs were measured by using a rapid mixing/filtration technique.26 Briefly, transport was initiated by mixing uptake buffer (40 µl, 137 mM choline chloride or NaCl) containing [3H]-glutamine of various concentrations with membrane vesicles (10 µl) at room temperature. Transport was terminated by adding ice-cold stop buffer (1 ml), rapidly filtering the mixture through a .45-µm membrane filter, and by washing the filter three times with stop buffer. The filter, containing the trapped [3H]-glutamine membrane vesicles, was dissolved in scintillation fluid and counted in scintillation counter. Transport activity was expressed as pmole glutamine/mg protein/time. The sodium-dependent system B glutamine transport activity was obtained by subtracting glutamine transport activity in choline chloride buffer from the total glutamine transport activity in sodium chloride buffer.

RNA Preparation
Jejunum was harvested and rinsed with ice-cold PBS to remove luminal debris. The jejunal mucosa was then scraped off the intestine and immediately frozen in liquid nitrogen. Total RNA was isolated from isolated jejunal epithelia with the use of Ambion Totally RNA kit (Ambion, Austin, TX).

Relative Real Time RT-PCR Analysis of Glutamine Transporter System B (ATB0) mRNA
Using extracted total RNA, relative real time reverse transcriptase-polymerase chain reaction (QRT-PCR) was performed in the Pennsylvania State University Molecular Core Facility using ABI Prism 7700 Sequence Detection System and SDS 1.9.1 Software. Specific ATB0 primers (Forward Primer 5' TTTCTGGAACTCCTGAGGAAT 3', Reverse Primer 5' TTCATCTTCATCTCACAGTGAG 3') and Taqman-labelled probe (5' TCCACAGAGGAGCAATGCAACCA 3') were obtained from MWG Biotech (High Point, NC). Relative quantitation of gene expression was calculated using 18S primers and probe obtained from ABI. (Applied Biosciences, Foster City, CA) Standard curves were constructed for both target (ATB0) and endogenous control (18S) using a cDNA sample. For each experimental sample, the amount of target and endogenous reference was determined using the appropriate standard curve. Then the target amount was divided by the endogenous reference amount to obtain a normalized target value.

Western Blot Analysis of Glutamine Transporter System B (ATB0) Protein
Whole cell protein lysate was used to measure System B transporter protein. Protein concentration was determined by BioRad protein kit (Hercules, CA). Relative protein measurements were based on equal protein loading in control and treatment samples. Protein was subjected to gel-electrophoresis and transferred to membranes. Transfer membranes were hybridized with antibody specific to system B developed in our laboratory. We developed a specific polyclonal antibody against a human 17 amino acid peptide in rabbits that is within the intracellular C-terminal of ATB0. The equivalent human and rat sequences differ in four amino acids. The antibody recognizes a 54 KDa protein in BBMV from rat jejunum and no bands in rat liver plasma membrane vesicles. Autoradiographs were scanned with a laser densitometer.

Whole blood glutamine
Blood samples were taken from the aorta (.5 cc) and portal vein (.5 cc). Heparinized whole blood was mixed with an equal volume of 10% ice-cold perchloric acid, vortexed and centrifuged. The supernatant was neutralized to PH 4.75 and stored at –70. Glutamine was measured employing microfluorometric enzymatic assays adapted from the method described by Bergmeyer.27

Statistical Analysis
Experimental means are reported ±SEM. Data was analyzed with paired Student t test. Values were considered significantly different if P ≤ .05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 CONCLUSION
 REFERENCES
 
Effect of tumor growth on jejunal mucosal glutamine transport activity
Glutamine transport experiments were carried out using BBMV from control and tumor bearing rats, in either NaCl or Choline Chloride uptake buffer, to measure total and sodium-independent transport, respectively. The difference between the two represents sodium-dependent transport. Glutamine transport was linear up to at least 20 s in either uptake buffer. Therefore, a 10-s transport time was used for subsequent measurements. At tumor weight less than 15%, total and sodium-dependent glutamine transport across the intestinal BBM in tumor-bearing rats was not significantly different from control rats (Sodium-dependent glutamine transport TBR 85.9 ± 4.4 vs. Control 63.2 ± .8 pmol/mg protein/ 10s, P > .05). At tumor weight greater than 15%, total glutamine transport activity across the intestinal BBM was 3.7-fold higher in tumor-bearing rats (TBR) than in controls (TBR 153 ± 22.6 vs. Control 41.9 ± 9.7 pmol/mg protein/10s, P < .01); with sodium-dependent transport accounting for the majority of the transport (TBR 71.7 ± 10.8 vs. Control 17 ± 2.6 pmol/mg protein/10s) (Fig. 1Go).


Figure 1
View larger version (13K):
[in this window]
[in a new window]

  		FIG. 1. Glutamine transport activity across intestinal brush border membrane vesicles (BBMV) in tumor-bearing rats (TBR) (tumor weight greater than 15%, average tumor weight 20%) and pair-fed controls. [3H]-Glutamine (1 µmol/l to 10 mmol/l) transport was measured in jejunal BBMV. Transport values are mean ± SEM (n = 9). *P < .01.

 
Effect of tumor growth on jejunal mucosal System B (ATB0) mRNA levels
The principle glutamine transporter system B (ATB0) mRNA levels were measured using relative real time PCR (QRT-PCR) in TBR and control rats. At tumor weight less than 15% intestinal BBM glutamine transporter ATB0 mRNA levels in tumor-bearing rats were not significantly different from control rats (Relative values: TBR .84 ± .81vs. Control .69 ± .07, P > .05). At tumor weight greater than 15%, intestinal BBM glutamine transporter ATB0 mRNA levels were 1.4-fold higher in TBR compared to controls (Relative values TBR .61 ± .12 vs. Control .43 ± .1, P < .05) (Fig. 2Go).


Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 2. Intestinal BBM glutamine transporter ATB0 mRNA levels in tumor-bearing rats (TBR) (tumor weight greater than 15%, average tumor weight 20%) and pair-fed controls were measured using relative real time reverse transcriptase-polymerase chain reaction (QRT-PCR). The abundance of target mRNA was calculated relative to the reference mRNA (18S) using relative expression ratios. For each experimental sample, the amount of target and endogenous reference was determined using the appropriate standard curve. Then the target amount was divided by the endogenous reference amount to obtain a normalized target value. Relative mRNA levels are mean ± SEM (n = 11). *P < .05. The Graph to the right is a representative amplification plot of the fluorescence signal for target and endogenous control versus cycle number.

 
Effect of tumor growth on jejunal mucosal System B (ATB0) transport protein
System B (ATB0) specific antibody was used on whole cell protein lysate from TBR and control rats. At tumor weight less than 15%, intestinal BBM glutamine transporter ATB0 protein levels in tumor-bearing rats were not significantly different from control rats (Relative values TBR 1.08 ± .16 vs. Control .76 ± .18, P > .05). A 1.4-fold increase in transporter ATB0 protein levels was observed in the TBR compared to controls (Relative values TBR .52 ± .07 vs. Control .37 ± .04, P < .05) (Fig. 3Go).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

  		FIG. 3. Intestinal BBM glutamine transporter ATB0 protein levels in tumor-bearing rats (TBR) (tumor weight greater than 15%, average tumor weight 20%) and pair-fed controls were measured using western blot technique. Relative protein measurements were based on equal protein loading in control and treatment samples. Relative protein levels are mean ± SEM (Control n = 10, TBR n = 9). *P < .05.

 
Effect of tumor growth on plasma glutamine levels
Circulating aortic plasma and portal venous glutamine levels were higher in tumor-bearing rats compared to control rats independent of tumor size. At tumor weight greater than 15%, circulating aortic plasma glutamine levels were 1.3-fold higher in TBR compared to controls (TBR [Glutamine] .74 ± .01 vs. Control [Glutamine] .63 ± .02 mmol/l, P < .0001). Portal venous glutamine levels were also higher in TBR compared to controls (TBR [Glutamine] .60 ± .02 vs. Control [Glutamine] .47 ± .01 mmol/l, P < .0001) (Fig. 4Go). Glutamine extraction across the intestine was lower in tumor bearing rats with [(portal glutamine – aortic glutamine)/aortic glutamine] concentration ratio higher in tumor-bearing rats (–.26 ± .02 Control vs. –.19 ± .02 mmol/l TBR, P < .05), indicating an increase in intestinal luminal glutamine absorption in excess of intestinal mucosal glutamine consumption (Fig. 5Go).


Figure 4
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 4. Aorta and Portal plasma glutamine levels were measured in tumor-bearing rats (TBR) (tumor weight greater than 15%, average tumor weight 20%) and pair-fed controls. Glutamine concentrations are mean ± SEM (n = 24). *P < .05.

 

Figure 5
View larger version (13K):
[in this window]
[in a new window]

  		FIG. 5. lutamine extraction across the baso-lateral membrane in the tumor-bearing rats (TBR) (tumor weight greater than 15%, average tumor weight 20%) and pair-fed controls was calculated from aorta and portal glutamine concentrations (Portal – Aorta/ Aorta). Glutamine flux is expressed as mean ± SEM (n = 24). *P < .05.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
CONCLUSION
 REFERENCES
 
In this in vivo study, we investigated the effect of MCA-sarcoma growth on intestinal mucosal glutamine transporter ATB0 in a tumor-bearing rat model. Various tumor growth stages (5–25% body weight) were assessed. Analysis was performed on two subgroups; those with tumor weight less than 15% (average weight 10%) and those with tumor weight greater than 15% (average weight 20%). This cutoff was used given that stigmata of cancer cachexia become visibly evident once tumor weight reaches around 20% body weight.26 The tumor bearing and control rats were pair-fed to account for observed fall in voluntary food intake (tumor-induce anorexia) that may confound the changes in inter-organ glutamine metabolism.4

Glutamine transport across rat intestinal brush border membrane is predominantly via sodium-dependent transport System B.25 Our experiments revealed that rat intestinal brush border membrane glutamine transport was significantly increased in tumor bearing rats compared to controls once tumor weight reached greater than 15%. Sodium dependent glutamine transport accounted for the majority of this increase. Our glutamine transport study confirmed the findings of Salloum et al. who demonstrated that the rate of glutamine uptake by brush border membrane vesicles (BBMV) in tumor-bearing rats (TBR) was significantly greater than controls, regardless of tumor size. They also demonstrated that the increase was due to increased maximum transport capacity, not transport affinity, and was specific to glutamine.26

Several mechanisms may be involved in the altered membrane transport activity, including, altered existing transporter affinity, translocation of pre-made transporters and/or de novo synthesis of transporters. Given that System B (ATB0) has been shown to be the predominant transporter in the intestinal brush border membrane, we focused are experiments on this system. The elevated steady state glutamine transporter ATB0 mRNA levels, seen in our experiments, suggested increased transcription and/or decreased degradation of this transporter gene. Similar up-regulation of system B mRNA has previously been shown in other catabolic states including sepsis (Pan 2005; unpublished data) and acidosis,28 suggesting a compensatory mechanism in the body to maintain glutamine homeostasis. Furthermore, we demonstrated an increase in system B (ATB0) transporter protein levels in the tumor bearing rats compared to controls, suggesting elevated transcription and formation of increased functional transporter units.

Catabolic states, including cancer cachexia, inflammation, sepsis, malnutrition and surgery are characterized by a fall in blood glutamine levels and tissue glutamine depletion becomes a hallmark. Dietary supplementation of glutamine could have the beneficial effect of restoring the levels of glutathione inside natural killer cells, maintaining muscle glutamine concentrations and ameliorating intestinal mucosal injury, bacterial translocation and gut-derived systemic infection. At the same time, since glutamine consumption by tumors is almost absolutely dissipative, an increase in the growth rate of the tumor with glutamine supplementation should not be expected.29

In our experiments, we found that both aortic and portal vein glutamine concentrations were higher in tumor bearing rats than in control rats suggesting that, at least in part, the increased circulating glutamine level was due to a net increase in intestinal glutamine absorption under our experimental conditions. We also found that there was a decrease in glutamine extraction across the basolateral membrane in the tumor-bearing rats compared to controls in our experiments, as determined by aorta and portal glutamine concentrations (Portal – Aorta/Aorta), suggesting an increase in intestinal luminal glutamine absorption in excess of intestinal mucosal glutamine consumption. This compensatory mechanism presumably helps maintain plasma glutamine concentration for synthetic functions in the body. An increase in brush border membrane glutamine transport, as shown in our experiments, would thus be vital to maintain intestinal mucosal integrity locally and homeostasis systemically.


   CONCLUSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
REFERENCES
 
Intestinal brush border membrane glutamine transport activity, transporter ATB0 mRNA and transporter protein levels are up-regulated in fibrosarcoma-bearing rats, leading to increased intestinal glutamine absorption capacity and circulating glutamine concentration, potentially restoring homeostasis in tumor-bearing states.


   FOOTNOTES
 
Presented at the 59th Society of Surgical Oncology Annual Meeting, San Diego, CA, March 23–26, 2006.

Received for publication May 22, 2006. Accepted for publication May 23, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 REFERENCES
 

  1. Chance WT, Cao L, Nelson JL, Foley-Nelson T, Fischer JE. Hyperammonemia in anorectic tumor-bearing rats. Life Sci 1988; 43:67–74.[CrossRef][Medline]
  2. Fisher JE, Chance WT. Total parenteral nutrition, glutamine and tumor growth. JPEN 1990; 14(S):86S–9S.
  3. Medina MA. Glutamine and cancer. J Nutr 2001; 131(9S):2539S–42S.[Abstract/Free Full Text]
  4. Souba WW. (1991) Glutamine: Physiology, biochemistry, and nutrition in critical illness. Austin: RG Landes..
  5. Knox WE, Horowitz ML, Friedell GH. The proportionality of glutaminase content to growth rate and morphology of rat neoplasms. Cancer Res 1969; 29:669–80.[Abstract/Free Full Text]
  6. Souba WW. Glutamine and cancer. Ann Surg 1993; 218:715–728.[Medline]
  7. Medina MA, Sánchez-Jiménez F, Márquez J, Quesada AR, de Núñez Castro I. Relevance of glutamine metabolism to tumor cell growth. Mol Cell Biochem 1992; 113:1–15.[Medline]
  8. Hammarqvist F, Wernerman J, Ali R, Von der Decken A, Vinnars E. Addition of glutamine to total parenteral nutrition after elective abdominal surgery spares free glutamine in muscle, counteracts the fall in muscle protein synthesis and improves nitrogen balance. Ann Surg 1989; 209:455–461.[Medline]
  9. Chen MK, Austgen TR, Salloum RM. Skeletal muscle glutamine metabolism in the tumor bearing rat. JPEN 1991; 15(S):185.
  10. Bozzetti F, Garazzi C, Cozzaglio L, Costa A, Spinelli P, Viola G. Total parenteral nutrition and tumor growth in malnourished patients with gastric cancer. Tumori 1999; 85(3):163–6.[Medline]
  11. Cameron IL. Total parenteral nutrition in methylcholantherene-induced rat sarcoma model. Cancer Treat Rep 1981; 65(S5):137–43.[Medline]
  12. Nixon DW, Moffitts S, Lawson DH, Ansley J, Lynn MJ, Kutner MH, Heymsfield SB, et al. Total parenteral nutrition as an adjunct to chemotherapy of metastatic colorectal cancer. Cancer Treat Rep 1981; 65(S5):121–8.[Medline]
  13. Austgen TR, Dudrick PS, Sitren H, Bland KI, Copeland EM, Souba WW. The effects of glutamine-enriched total parenteral nutrition on tumor growth and host tissues. Ann Surg 1992; 215:107–13.[Medline]
  14. Chen MK, Austgen TR, Klimberg VS. Tumor glutamine use exceeds intestinal glutamine use in cachectic tumor bearing rats. Surg Forum 1990; 41:12–4.
  15. Souba WW, Strebel FR, Bull JM, Copeland EM, Teagtmeyer H, Cleary K. Interorgan glutamine metabolism in the tumor bearing rat. J Surg Res 1988; 44:720–6.[CrossRef][Medline]
  16. Klimberg VS, Souba WW, Salloum RM. Glutamine enriched diets support muscle glutamine metabolism without stimulating tumor growth. J Surg Res 1990; 48:319–23.[CrossRef][Medline]
  17. Bartlett DL, Charland S, Torosian MH. Effect of glutamine on tumor and host growth. Ann Surg Oncol 1995; 2(1):71–76.[Abstract]
  18. Chance WT, Cao L, Nelson JL, Fischer JE. Reduction of tumor growth following treatment with a glutamine antimetabolite. Life Sci 1988; 42:87–94.[CrossRef][Medline]
  19. Chance WT, Cao L, Fischer JE. Insulin and acivicin improve host nutrition and prevent tumor growth during total parenteral nutrition. Ann Surg 1988; 208(4):524–31.[Medline]
  20. Rouse K, Nwokedi E, Woodliff JE, Epstein J, Klimberg VS. Glutamine enhances selectivity of chemotherapy through changes in glutathione metabolism. Ann Surg 1995; 221:420–6.[Medline]
  21. Burke D, Alverdy JC, Aoys E, Moss GS. Glutamine supplemented TPN improves gut immune function. Arch Surg 1989; 124:1396–9.[Abstract/Free Full Text]
  22. Souba WW, Herskowitz K, Austgen TR, Chen MK, Salloum RM. Glutamine nutrition: Theoretical considerations and therapeutic impact. JPEN 1990; 14(5):237S–43S.
  23. Fox AD, Kripke SA, DePaula J, Berman JM, Settle RG, Rombeau JL. Effect of a glutamine-supplemented enteral diet on methotrexate-induced enterocolitis. JPEN 1988; 12:325–31.[Abstract/Free Full Text]
  24. Klimberg VS, Souba WW, Dolson DJ. Oral glutamine supports crypt cell turnover and accelerates intestinal healing following abdominal radiation. JPEN 1989; 13(S1):35.
  25. Stevens BR, Kaunitz J, Wright EM. Intestinal transport of amino acids and sugars: Advances using membrane vesicles. Ann Rev Physiol 1984; 417:417.
  26. Salloum RM, Copeland EM, Bland KI, Souba WW. Selective stimulation of brush border glutamine transport in the tumor bearing rat. J Surg Res 1992; 50:391–7.
  27. Bergmeyer HU eds. (1974) Methods of enzymatic analysis. New York: Academic..
  28. Pan M, Meng QH, Choudry HA, Karinch AM, Lin CM, Souba WW. Stimulation of intestinal glutamine absorption in chronic metabolic acidosis. Surgery 2004; 136(2):127–34.[CrossRef][Medline]
  29. Crabtree N, Newsholme EA. A quantitative approach to metabolic control. Curr Top Cell Regul 1985; 25:21–76.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choudry, H. A.
Right arrow Articles by Pan, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choudry, H. A.
Right arrow Articles by Pan, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS