Annals of Surgical Oncology Cite Track
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/ASO.2006.05.028
Annals of Surgical Oncology 13:802-808 (2006)
© 2006 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.

Original Article

Expression of Interleukin 11 and Its Receptor and Their Prognostic Value in Human Breast Cancer

Satheesha Hanavadi, MS, FRCS, Tracey A. Martin, PhD, Gareth Watkins, HND, Robert E. Mansel, MS, FRCS and Wen G. Jiang, MB, MCh, MD

University Department of Surgery, Wales College of Medicine, Cardiff University, Heath Park, Cardiff CF4 4XN, United Kingdom

Correspondence: Address correspondence and reprint requests to: Satheesha Hanavadi, MS, FRCS; E-mail: satheeshh{at}yahoo.com


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Background: Recent experimental evidence has shown a potential role of interleukin (IL)-11 and its receptor in breast cancer development and progression. However, there is little clinical information to support this hypothesis. We examined the expression of IL-11 and its receptor in primary breast cancer tissue samples and correlated their level of expression with the clinical outcome.

Methods: Primary breast cancer samples (n = 109) and matched background tissue obtained from patients in the cohort (n = 33) were processed for frozen section and RNA extraction. Frozen sections from matched tissues were immunostained with IL-11 and IL-11 receptor antibodies. Staining intensity was analyzed by computer image analysis. RNA was reverse-transcribed and quantified before analysis by quantitative polymerase chain reaction. Results were expressed as the number of transcripts (standardized by ß-actin). The data were compared with the clinical outcome of the disease.

Results: The intensity of staining for both IL-11 and the IL-11 receptor was distinctly high in tumor samples (P < .01). The transcript level of IL-11 was significantly higher in node-positive tumor samples compared with node-negative samples (P = .02). Tumors with a poor prognostic index and poor histological grade showed a higher level of IL-11. A higher level of IL-11 was linked to poorer survival with Kaplan-Meier survival analysis.

Conclusions: IL-11 can be a predictor of poor prognosis in human breast cancer.

Key Words: Interleukin 11 • Interleukin-11 receptor • Breast cancer • Prognosis • Survival


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Breast cancer is the most common cancer in women in the United Kingdom in terms of incidence and mortality and is the leading cause of cancer deaths among women globally.1 Although major work has been focused on tackling the problem of breast cancer, our understanding of the molecular and cellular mechanisms that underlie cancer progression remains poor. Many prognostic indicators have been identified which serve as guides for clinical decisions and estimates of outcome. Parameters such as nodal status, histological grade, tumor size, and distant metastasis are well-known prognostic factors, and various prognostic indices have been devised by combining these factors. Similarly, biological markers such as estrogen and progesterone receptor status and HER-2/neu have been targeted in breast cancer treatment and, therefore, used as predictors of the clinical outcome.

Although these prognostic indicators, to a certain extent, help to assess the severity of the disease at the time of diagnosis and, hence, to plan management, they are not always a good indicator of behavior in individual breast cancer cases. Advances in molecular biology have provided new tools to predict aggressiveness in human breast cancer. As a result, many genetic factors have been identified whose expression in breast cancer cells may be suggestive of a poor prognosis. Van ‘t Veer et al.2 and Kang et al.3 identified the gene-expression profile of the primary tumor that can predict (1) breast cancer prognosis and (2) the ability to form aggressive bone metastases, respectively.

Recently, some experimental evidence has shown the possible role of interleukin (IL)-11 in bone metastasis of breast cancer. Breast cancer cells are known to express IL-11 receptor (IL-11R) and secrete IL-11, which in turn have been shown to stimulate osteoclasts.4–8 Increased osteoclast activity has been demonstrated near the margin of bone metastasis both in patients and in experimental models.9,10 This led to the hypothesis that IL-11 may play a significant role in the bone metastasis of human breast cancer.7 Other studies have shown breast cancer cells to induce osteoclast formation by stimulating host IL-11 production.11 Although the studies have addressed the link between IL-11 and bone metastasis, there is little information on the expression pattern of IL-11 and its receptor in primary human breast cancer cases. This study examined the expression of IL-11 and its receptor in tissue samples from primary human breast cancer cases and correlated its level of expression with the clinical outcome.


   METHODS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Patients and Tumor Samples
Breast cancer tissue and background tissue (normal breast tissue) samples were obtained from a fresh frozen tissue bank in the Department of Surgery, University Hospital of Wales, Cardiff. These samples were collected between 1992 and 1995. The cases were selected randomly, and the follow-up data were updated regularly. The duration of follow-up ranged from 36 to 146 months (median, 110 months). Patients who could not be followed up and those who died of other causes were excluded from the study. The clinical data, including the prognostic factors of each sample, were collected, and the Nottingham Prognostic Index (NPI)12 was calculated. The histological grade of the disease was determined on the basis of a modified Bloom and Richardson’s grading system.13 A total of 142 samples of background tissue (n = 33) and cancer tissue (n = 109) were studied. Nine patients developed metastatic disease on follow-up, and local recurrence was noted in six patients. Fifteen patients died of breast cancer–related causes during follow-up.

Preparation of RNA and Complementary DNA, Reverse Transcription-Polymerase Chain Reaction, and Quantitative Polymerase Chain Reaction
The frozen sections of breast specimens were homogenized at room temperature with 1 mL of RNA reagent by using a homogenizer (Ultra-Turrax T8; IKA Labortechnik, North Cave, Humberside, UK). Total RNA was extracted from each sample by using the guanidinium thiocyanate method (RNAzol procedure).14 A complementary DNA (cDNA) was synthesized. The cDNA was quantified by quantitative polymerase chain reaction (Q-PCR). The Q-PCR system used the Amplofluor Uniprimer system (Intergen Company, Oxford, UK) and Thermo-Start (ABgene, Epsom, Surrey, UK), as reported recently from our center.15 Specific primer pairs for IL-11 and its receptor were designed by the authors by using Beacon design software and were manufactured by Invitrogen (Invitrogen Life Technologies, Paisley, Scotland, UK). Each amplified a region that spanned at least 1 intron, thus generating approximately 100 base pair products from both the control plasmid and cDNA. Sequences used were as follows: for IL-11—GACAGGGAAGGGTTAAAGG, IL11F1 (forward primer-1); ACTGAACCTGACCGTACAGCTGTATCTGGCCA CAGG, IL11Zr (reverse primer with Z sequence underlined); for IL-11R—CTCCTGACCCGCTCTCTC, IL11RF1; ACTGAA CCTGACCGTACAGGAATCCAGGTTGTGGTC, IL11Zr. Beta actin was used as the housekeeping control: 5'-ATGATATCGCCGCGCTCG-'3 and 5'-CGCTCGTGTAGGATCTTCA-'3.

By using the Icycler IQ system (Bio-Rad, Hemel Hamstead, UK), the plasmid standards and the breast cancer cDNA were simultaneously assayed in duplicated reactions with a standard hot-start Q-PCR master mix. Q-PCR conditions were as follows: enzyme activation at 95°C for 12 minutes for 1 cycle followed by 60 cycles of denaturation (95°C for 15 seconds), annealing (55°C for 40 seconds), and extension (72°C for 25 seconds). By using purified plasmids as internal standards, the levels of each tight junction molecule of cDNA (copies per 50 ng of RNA) in the breast cancer samples were calculated. Q-PCR for ß-actin was also performed on the same samples to correct for any residual differences in the initial level of RNA in the specimens (in addition to spectrophotometry). The products of Q-PCR were verified on agarose gels.

Immunohistochemistry
We recently described the methodology for immunostaining.16 Paired samples (n = 33) were processed for immunohistochemical analysis. Cryostat sections of frozen tissues were cut at 6 mm, placed on Superfrost Plus slides (Fisher Scientific, Cardiff, UK), air-dried, and fixed in a 50:50 solutions of alcohol and acetone. The sections were air-dried again and stored at –20°C. Just before immunostaining commenced, the sections were washed in buffer for 5 minutes and treated with serum buffer solution for 20 minutes as a blocking agent to nonspecific binding. Sections were stained with IL-11 and IL-11R antibodies (Santa-Cruz Biotechnology, Santa Cruz, CA). Primary antibodies were used at 1/50 dilution for 60 minutes and then washed in buffer. The secondary biotinylated antibody at 1/100 dilution (Universal Secondary, Vectastain Elite ABC; Vector Laboratories Inc., Burlingame, CA) was added (in horse serum/buffer solution) for 30 minutes, followed by numerous washings in buffer. The sections were then treated with avidin/biotin complex for 30 minutes, followed with buffer washing. Diaminobenzidine was used as a chromogen to visualize the antibody/antigen complex. Sections were counterstained in Mayer’s hematoxylin for 1 minute, dehydrated, cleared, mounted in DPX mounting medium (Raymond A. Lamb, London, UK), and screened with an x25 objective. For negative control, the primary antibodies were omitted, but otherwise the methodology was the same. The intensity of staining, which is directly related to the quantity of IL-11 in the section, was analyzed with the density analysis package of Optimas 6.0 software (Nothell, WA).17,18

Statistical Analysis
The Q-PCR products and the intensity of immunostaining of each sample were analyzed against different prognostic parameters. The mean value for each parameter was calculated, and statistical analysis was performed by using the Mann-Whitney test (Minitab version 14, State College, PA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Immunostaining of Mammary Epithelial Cells and Breast Cancer Cells for IL-11 and Its Receptor
Figure 1Go shows the intensity of staining for IL-11 and IL-11R in tumor and background tissues. The staining was poor in healthy mammary tissues (Fig. 1AGo), in contrast to breast cancer cells (Fig. 1BGo), which showed strong positive staining for IL-11. The staining intensity for IL-11 in healthy tissue was .0422 ± .018, compared with .107 ± .039 in tumor tissue (P = .00017).


Figure 1
View larger version (182K):
[in this window]
[in a new window]
  		FIG. 1. Immunostaining of background mammary tissue (A) and breast cancer tissue (B) for interleukin 11 (original magnification, x100; inset, x400). A higher intensity of staining was noted in the tumor sample (B) compared with healthy mammary tissue (A). (C) Negative control.

 
The staining pattern of IL-11R (Fig. 2Go) was similar to that of IL-11. The intensity of staining for IL-11R in healthy tissue was .108 ± .035, compared with .193 ± .0032 in tumor samples (P = .0001).


Figure 2
View larger version (184K):
[in this window]
[in a new window]
  		FIG. 2. Immunostaining of background mammary tissue (A) and breast cancer tissue (B) for interleukin 11 receptor (original magnification, x100; inset, x400). A higher intensity of staining was noted in the tumor sample (B) compared with healthy mammary tissue (A). (C) Negative control.

 
Expression of IL-11 and IL-11R in Healthy Mammary and Breast Cancer Tissues
By using conventional reverse transcription-polymerase chain reaction, we showed that the expression of IL-11 and IL-11R was comparatively stronger in tumor samples than in matched background tissue samples (Fig. 3Go; Table 1Go). On quantitative analysis, the transcript levels of both IL-11 and IL-11R, although visibly increased in breast tumor tissues compared with normal tissues, showed no significant statistical difference (P = .91 and .14, respectively). The correlation coefficient between IL-11 staining intensity (from image analysis) and IL-11 gene transcription (from Q-PCR analysis) was .361, and for IL-11R it was .391 (Spearman correlation test).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3. Reverse transcription-polymerase chain reaction demonstrating high expression of interleukin 11 (A) and interleukin 11 receptor (B) in tumor samples compared with matched healthy mammary tissues. N, normal mammary tissue; T, breast cancer tissue.

 

View this table:
[in this window]
[in a new window]
  		TABLE 1. Transcript levels (mean values) of IL-11 and IL-11 receptor in samples from primary breast cancer and background mammary tissues
 
Expression of IL-11 and Its Receptor and the Correlation With Nodal Involvement and With Predicted Prognosis
We first compared the levels of expression of IL-11 in node-positive and -negative tumors. A significantly higher transcript level of IL-11 was noted in node-positive tumor compared with node-negative tumor (P = .02; Fig. 4AGo). Similarly, samples with an NPI of 3 (poor prognosis) showed a high level compared with those with an NPI of 1 (P = .01; Fig. 4BGo; Table 1Go). High-grade tumors (grade 3) also showed a positive correlation with the expression of IL-11 (P = .005).


Figure 4
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 4. (A) Quantitative polymerase chain reaction (Q-PCR) analysis of breast cancer tissue samples showing higher transcript levels of interleukin 11 in node-positive samples compared with node-negative tumor samples (P = .02). (B) Q-PCR analysis showing higher transcript levels of interleukin 11 in poor-prognosis breast cancer cases.

 
When the transcript levels of IL-11R were compared, no significant difference was noted between node-positive and node-negative samples (P = .79). Similar statistical results were noted between different NPI levels (P = .40) and histological grades (P = .97).

Estrogen Receptor Status Has No Effect on Expression of Either IL-11 or IL-11R
No significant difference in either IL-11 or IL-11R levels was noted in estrogen receptor-positive compared with estrogen receptor-negative samples (P = .14 and .29, respectively).

IL-11 and IL-11R Levels Have an Association With Clinical Outcome
At the end of follow-up, patients were segregated into a good-prognostic group (remained disease free) and a group with poor clinical outcome (developed local recurrence or distant metastasis or died). Although the transcript levels of both IL-11 and IL-11R were higher in patients with local recurrence and distant metastasis and those who died of breast cancer (Table 1Go) than in patients who remained disease free, these differences were not statistically significant. However, when patients with a poor clinical outcome were combined and compared with the disease-free group, a statistically significant difference was noted in the transcript levels of both IL-11 and IL-11R (P = .04 and P = .02, respectively; Fig. 5Go).


Figure 5
View larger version (12K):
[in this window]
[in a new window]
  		FIG. 5. A higher transcript level of interleukin 11 (A) and its receptor (B) was linked to poor survival in human breast cancer. recurr., recurrence.

 
By using Kaplan-Meier survival analysis, it was revealed that higher transcript levels of IL-11 were significantly correlated with a poor disease-free survival (Fig. 6Go; P = .01). Neither IL-11 nor IL-11R was linked with overall survival.


Figure 6
View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6. Kaplan-Meier survival analysis showing a correlation between higher transcript levels of interleukin (IL)-11 and poor disease-free survival. Patients with high levels of IL-11 transcript had a median disease-free survival of 110.6 months (95% confidence interval, 94.5–126.7 months). Those who had low levels of IL-11 had a median disease-free survival of 137.5 months (95% confidence interval, 124.4–150.5 months; P = .01). Cum, cumulative.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
CONCLUSIONS
 REFERENCES
 
IL-11 is a pleiotropic cytokine, described initially in 1990 as a bone marrow stroma-derived hemopoietic cytokine.19 IL-11 is expressed by a variety of tissues, such as gut, brain, spinal cord neurons, and testes, and hence may have a physiological role in these organs.20 Breast cancer cells have been shown to secrete IL-11, and its possible role in bone metastasis of breast cancer has been studied previously. In our study, we compared the level of IL-11 and its receptor in healthy and cancerous breast tissue. Similarly, we compared IL-11 levels among breast cancer tissue samples with known prognostic parameters and analyzed the clinical outcome on follow-up.

We found that an increased level of IL-11 in breast cancer samples corresponded to aggressive behavior of breast cancer. This was demonstrated by increased expression in samples from node-positive cancer cases, high-grade tumors, and tumors with a poor clinical prognostic index.

A recent study reported that expression of IL-11 by breast cancer cells is associated with an increased risk of bone metastasis.21 No such difference was demonstrated in our study. Similarly, no significant difference in either IL-11 or IL-11R levels was found when the disease-free sample was compared individually against samples from patients with local recurrent disease and those who died. This may be due to the small sample sizes of these groups compared with the disease-free sample. When the samples with poor clinical outcome were combined, a statistically significant difference in IL-11 and IL-11R levels was noted. Although a large sample is needed in each group to show the correlation between IL-11 and the clinical outcome, the combined value can be indirect evidence to show the positive relation between IL-11 level and poor survival.

Thus, the primary breast cancer that expresses a higher level of IL-11 is more likely to be node positive, to have a poor histological grade, and to have a poor predicted prognosis. Similarly, samples showing higher levels of IL-11 are more likely to develop local recurrence and distant metastasis and to have poor survival.

Many prognostic indicators have been used to assess the probable prognosis in any given case. Identifying these cases early in their progress is a key factor in reducing morbidity and mortality. IL-11 is a poor-prognostic indicator in human breast cancer. The mechanism by which IL-11 acts is not understood yet. However, recent work on the potential role of IL-11 on bone metastasis of cancer cells indicates that the cytokine may have clinical bearing on the spread of breast cancer cells, as well as conferring aggressiveness to cancer cells. Although we can formulate an arbitrary cutoff value for IL-11 for it to be of more clinical significance to predict prognosis, a large study is needed to put forward a numerical value for international debate and agreement. This study has shown that increased expression of IL-11 is associated with poor prognosis in human breast cancer. Further research in this field might reveal new effective therapeutic or preventive strategies in human breast cancer.


   CONCLUSIONS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
REFERENCES
 
IL-11 expression is increased in node-positive, high-grade breast cancer and is associated with poor survival. We propose that IL-11 can be considered a predictor of poor prognosis in human breast cancer.


   ACKNOWLEDGMENTS
 
The authors are grateful to Cancer Research Wales and to Breast Cancer Campaign, Cardiff, for their support to carry out this research work.

Received for publication May 24, 2005. Accepted for publication November 11, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 

  1. Pisani P, Parkin DM, Ferlay J. Estimates of worldwide mortality from eighteen major cancers in 1985. Implications for prevention and projections of future burden. Int J Cancer 1993; 55:891–903.[Medline]
  2. Van ’t Veer LJ, Dai H, Van De Vijver MJ, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature 2002; 415:530–6.[CrossRef][Medline]
  3. Kang Y, Seigel PM, Shu W, et al. A multigenic program mediating breast cancer metastasis to bone. Cancer Cell 2003; 3:537–49.[CrossRef][Medline]
  4. Crichton MB, Nichols JE, Zhao Y, Bulun SE, Simpson ER. Expression of transcript of interleukin-6 and related cytokines by human breast tumours, breast cancer cells and adipose stromal cells. Mol Cell Endocrinol 1996; 118:215–20.[CrossRef][Medline]
  5. Douglas AM, Goss GA, Sutherland RL, et al. Expression and function of members of the cytokine receptor superfamily on breast cancer cells. Oncogene 1997; 14:661–9.[CrossRef][Medline]
  6. Morinaga Y, Fujita N, Ohishi K, Zhang Y, Tsuruo T. Suppression of interleukin-11 mediated bone resorption by cyclo-oxygenase inhibitor. J Cell Physiol 1998; 175:247–54.[CrossRef][Medline]
  7. Lacroix M, Siwek B, Marie PJ, Body JJ. Production and regulation of interleukin-11 by breast cancer cells. Cancer Lett 1998; 127:29–35.[CrossRef][Medline]
  8. Manolagas SC, Jilka RL. Bone marrow, cytokines and remodelling. Emerging insights into the pathophysiology of osteoporosis. N Engl J Med 1995; 332:305–11.[Free Full Text]
  9. Guise TA, Mundy GR. Cancer and bone. Endocr Rev 1998; 19:18–54.[Abstract/Free Full Text]
  10. Arguello F, Baggs RB, Frantz CN. A murine model of experimental metastasis to bone and bone marrow. Cancer Res 1988; 48:6876–81.[Abstract/Free Full Text]
  11. Morgan H, Tumber A, Hill PA. Breast cancer cells induce osteoclast formation by stimulating host IL-11 production and down regulating granulocyte/macrophage colony-stimulating factor. Int J Cancer 2004; 109:653–60.[CrossRef][Medline]
  12. Galea MH, Blamey RW, Elston CE, Ellis IO. The Nottingham prognostic index in primary breast cancer. Breast Cancer Res Treat 1992; 22:207–19.[CrossRef][Medline]
  13. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. 1. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology 1991; 19:403–10.[Medline]
  14. Chomczynske P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–9.[Medline]
  15. Jiang WG, Watkins G, Lane J, et al. Prognostic value of Rho family and rho-GDIs in breast cancer. Clin Cancer Res 2003; 9:6432–40.[Abstract/Free Full Text]
  16. Martin TA, Goyal A, Watkins G, Jiang WG. Expression of the transcription factors snail, slug, and twist and their clinical significance in human breast cancer. Ann Surg Oncol 2005; 12:1–9.[Free Full Text]
  17. Davies G, Jiang WG, Mason MD. Cell–cell adhesion and signaling intermediates in human prostate cancer. J Urol 2000; 163:985–92.[CrossRef][Medline]
  18. King JAC, Ofori-Acquash AF, Stevens T, Al-Mehdi AB, Fodstad O, Jiang WG. Prognostic value of ALCAM in human breast cancer. Breast Cancer Res 2004; 6:478–87.
  19. Paul SR, Bennett F, Calvotti JA, et al. Molecular cloning of a cDNA encoding interleukin-11, a stromal cell-derived lymphopoietic and hematopoietic cytokine. Proc Natl Acad Sci USA 1990; 87:7512–6.[Abstract/Free Full Text]
  20. Du X, Williams DA. Interleukin-11: review of molecular, cell biology and clinical use. Blood 1997; 89:3897–908.[Free Full Text]
  21. Sotiriou C, Lacroix M, Lespagnard L, Larsimont D, Paesmans M, Body JJ. Interleukin-6 and -11 expression in primary breast cancer and subsequent development of bone metastasis. Cancer Lett 2001; 169:87–95.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
V. O. Lewis, M. G. Ozawa, M. T. Deavers, G. Wang, T. Shintani, W. Arap, and R. Pasqualini
The Interleukin-11 Receptor {alpha} as a Candidate Ligand-Directed Target in Osteosarcoma: Consistent Data from Cell Lines, Orthotopic Models, and Human Tumor Samples
Cancer Res., March 1, 2009; 69(5): 1995 - 1999.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
C.-C. Huang, S. Gadd, N. Breslow, C. Cutcliffe, S. T. Sredni, I. B. Helenowski, J. S. Dome, P. E. Grundy, D. M. Green, M. K. Fritsch, et al.
Predicting Relapse in Favorable Histology Wilms Tumor Using Gene Expression Analysis: A Report from the Renal Tumor Committee of the Children's Oncology Group
Clin. Cancer Res., March 1, 2009; 15(5): 1770 - 1778.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
P. Paiva, L. A. Salamonsen, U. Manuelpillai, and E. Dimitriadis
Interleukin 11 Inhibits Human Trophoblast Invasion Indicating a Likely Role in the Decidual Restraint of Trophoblast Invasion During Placentation
Biol Reprod, February 1, 2009; 80(2): 302 - 310.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Surg. Oncol.Home page
S. Hanavadi, T. A. Martin, G. Watkins, R. E. Mansel, and W. G. Jiang
The Role of Growth Differentiation Factor-9 (GDF-9) and Its Analog, GDF-9b/BMP-15, in Human Breast Cancer
Ann. Surg. Oncol., July 1, 2007; 14(7): 2159 - 2166.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Surg. Oncol.Home page
S. R. Davies, G. Watkins, R. E. Mansel, and W. G. Jiang
Differential Expression and Prognostic Implications of the CCN Family Members WISP-1, WISP-2, and WISP-3 in Human Breast Cancer
Ann. Surg. Oncol., June 1, 2007; 14(6): 1909 - 1918.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS