10.1245/ASO.2006.05.028
Annals of Surgical Oncology 13:802-808 (2006)
© 2006 Society of Surgical Oncology
Expression of Interleukin 11 and Its Receptor and Their Prognostic Value in Human Breast Cancer
Satheesha Hanavadi, MS, FRCS,
Tracey A. Martin, PhD,
Gareth Watkins, HND,
Robert E. Mansel, MS, FRCS and
Wen G. Jiang, MB, MCh, MD
University Department of Surgery, Wales College of Medicine, Cardiff University, Heath Park, Cardiff CF4 4XN, United Kingdom
Correspondence: Address correspondence and reprint requests to: Satheesha Hanavadi, MS, FRCS; E-mail: satheeshh{at}yahoo.com
 |
ABSTRACT
|
|---|
Background: Recent experimental evidence has shown a potential role of interleukin (IL)-11 and its receptor in breast cancer development and progression. However, there is little clinical information to support this hypothesis. We examined the expression of IL-11 and its receptor in primary breast cancer tissue samples and correlated their level of expression with the clinical outcome.
Methods: Primary breast cancer samples (n = 109) and matched background tissue obtained from patients in the cohort (n = 33) were processed for frozen section and RNA extraction. Frozen sections from matched tissues were immunostained with IL-11 and IL-11 receptor antibodies. Staining intensity was analyzed by computer image analysis. RNA was reverse-transcribed and quantified before analysis by quantitative polymerase chain reaction. Results were expressed as the number of transcripts (standardized by ß-actin). The data were compared with the clinical outcome of the disease.
Results: The intensity of staining for both IL-11 and the IL-11 receptor was distinctly high in tumor samples (P < .01). The transcript level of IL-11 was significantly higher in node-positive tumor samples compared with node-negative samples (P = .02). Tumors with a poor prognostic index and poor histological grade showed a higher level of IL-11. A higher level of IL-11 was linked to poorer survival with Kaplan-Meier survival analysis.
Conclusions: IL-11 can be a predictor of poor prognosis in human breast cancer.
Key Words: Interleukin 11 • Interleukin-11 receptor • Breast cancer • Prognosis • Survival
|
INTRODUCTION
|
|---|
Breast cancer is the most common cancer in women in the United Kingdom in terms of incidence and mortality and is the leading cause of cancer deaths among women globally.1 Although major work has been focused on tackling the problem of breast cancer, our understanding of the molecular and cellular mechanisms that underlie cancer progression remains poor. Many prognostic indicators have been identified which serve as guides for clinical decisions and estimates of outcome. Parameters such as nodal status, histological grade, tumor size, and distant metastasis are well-known prognostic factors, and various prognostic indices have been devised by combining these factors. Similarly, biological markers such as estrogen and progesterone receptor status and HER-2/neu have been targeted in breast cancer treatment and, therefore, used as predictors of the clinical outcome.
Although these prognostic indicators, to a certain extent, help to assess the severity of the disease at the time of diagnosis and, hence, to plan management, they are not always a good indicator of behavior in individual breast cancer cases. Advances in molecular biology have provided new tools to predict aggressiveness in human breast cancer. As a result, many genetic factors have been identified whose expression in breast cancer cells may be suggestive of a poor prognosis. Van ‘t Veer et al.2 and Kang et al.3 identified the gene-expression profile of the primary tumor that can predict (1) breast cancer prognosis and (2) the ability to form aggressive bone metastases, respectively.
Recently, some experimental evidence has shown the possible role of interleukin (IL)-11 in bone metastasis of breast cancer. Breast cancer cells are known to express IL-11 receptor (IL-11R) and secrete IL-11, which in turn have been shown to stimulate osteoclasts.4–8 Increased osteoclast activity has been demonstrated near the margin of bone metastasis both in patients and in experimental models.9,10 This led to the hypothesis that IL-11 may play a significant role in the bone metastasis of human breast cancer.7 Other studies have shown breast cancer cells to induce osteoclast formation by stimulating host IL-11 production.11 Although the studies have addressed the link between IL-11 and bone metastasis, there is little information on the expression pattern of IL-11 and its receptor in primary human breast cancer cases. This study examined the expression of IL-11 and its receptor in tissue samples from primary human breast cancer cases and correlated its level of expression with the clinical outcome.
|
METHODS
|
|---|
Patients and Tumor Samples
Breast cancer tissue and background tissue (normal breast tissue) samples were obtained from a fresh frozen tissue bank in the Department of Surgery, University Hospital of Wales, Cardiff. These samples were collected between 1992 and 1995. The cases were selected randomly, and the follow-up data were updated regularly. The duration of follow-up ranged from 36 to 146 months (median, 110 months). Patients who could not be followed up and those who died of other causes were excluded from the study. The clinical data, including the prognostic factors of each sample, were collected, and the Nottingham Prognostic Index (NPI)12 was calculated. The histological grade of the disease was determined on the basis of a modified Bloom and Richardson’s grading system.13 A total of 142 samples of background tissue (n = 33) and cancer tissue (n = 109) were studied. Nine patients developed metastatic disease on follow-up, and local recurrence was noted in six patients. Fifteen patients died of breast cancer–related causes during follow-up.
Preparation of RNA and Complementary DNA, Reverse Transcription-Polymerase Chain Reaction, and Quantitative Polymerase Chain Reaction
The frozen sections of breast specimens were homogenized at room temperature with 1 mL of RNA reagent by using a homogenizer (Ultra-Turrax T8; IKA Labortechnik, North Cave, Humberside, UK). Total RNA was extracted from each sample by using the guanidinium thiocyanate method (RNAzol procedure).14 A complementary DNA (cDNA) was synthesized. The cDNA was quantified by quantitative polymerase chain reaction (Q-PCR). The Q-PCR system used the Amplofluor Uniprimer system (Intergen Company, Oxford, UK) and Thermo-Start (ABgene, Epsom, Surrey, UK), as reported recently from our center.15 Specific primer pairs for IL-11 and its receptor were designed by the authors by using Beacon design software and were manufactured by Invitrogen (Invitrogen Life Technologies, Paisley, Scotland, UK). Each amplified a region that spanned at least 1 intron, thus generating approximately 100 base pair products from both the control plasmid and cDNA. Sequences used were as follows: for IL-11—GACAGGGAAGGGTTAAAGG, IL11F1 (forward primer-1); ACTGAACCTGACCGTACAGCTGTATCTGGCCA CAGG, IL11Zr (reverse primer with Z sequence underlined); for IL-11R—CTCCTGACCCGCTCTCTC, IL11RF1; ACTGAA CCTGACCGTACAGGAATCCAGGTTGTGGTC, IL11Zr. Beta actin was used as the housekeeping control: 5'-ATGATATCGCCGCGCTCG-'3 and 5'-CGCTCGTGTAGGATCTTCA-'3.
By using the Icycler IQ system (Bio-Rad, Hemel Hamstead, UK), the plasmid standards and the breast cancer cDNA were simultaneously assayed in duplicated reactions with a standard hot-start Q-PCR master mix. Q-PCR conditions were as follows: enzyme activation at 95°C for 12 minutes for 1 cycle followed by 60 cycles of denaturation (95°C for 15 seconds), annealing (55°C for 40 seconds), and extension (72°C for 25 seconds). By using purified plasmids as internal standards, the levels of each tight junction molecule of cDNA (copies per 50 ng of RNA) in the breast cancer samples were calculated. Q-PCR for ß-actin was also performed on the same samples to correct for any residual differences in the initial level of RNA in the specimens (in addition to spectrophotometry). The products of Q-PCR were verified on agarose gels.
Immunohistochemistry
We recently described the methodology for immunostaining.16 Paired samples (n = 33) were processed for immunohistochemical analysis. Cryostat sections of frozen tissues were cut at 6 mm, placed on Superfrost Plus slides (Fisher Scientific, Cardiff, UK), air-dried, and fixed in a 50:50 solutions of alcohol and acetone. The sections were air-dried again and stored at –20°C. Just before immunostaining commenced, the sections were washed in buffer for 5 minutes and treated with serum buffer solution for 20 minutes as a blocking agent to nonspecific binding. Sections were stained with IL-11 and IL-11R antibodies (Santa-Cruz Biotechnology, Santa Cruz, CA). Primary antibodies were used at 1/50 dilution for 60 minutes and then washed in buffer. The secondary biotinylated antibody at 1/100 dilution (Universal Secondary, Vectastain Elite ABC; Vector Laboratories Inc., Burlingame, CA) was added (in horse serum/buffer solution) for 30 minutes, followed by numerous washings in buffer. The sections were then treated with avidin/biotin complex for 30 minutes, followed with buffer washing. Diaminobenzidine was used as a chromogen to visualize the antibody/antigen complex. Sections were counterstained in Mayer’s hematoxylin for 1 minute, dehydrated, cleared, mounted in DPX mounting medium (Raymond A. Lamb, London, UK), and screened with an x25 objective. For negative control, the primary antibodies were omitted, but otherwise the methodology was the same. The intensity of staining, which is directly related to the quantity of IL-11 in the section, was analyzed with the density analysis package of Optimas 6.0 software (Nothell, WA).17,18
Statistical Analysis
The Q-PCR products and the intensity of immunostaining of each sample were analyzed against different prognostic parameters. The mean value for each parameter was calculated, and statistical analysis was performed by using the Mann-Whitney test (Minitab version 14, State College, PA).
|
RESULTS
|
|---|
Immunostaining of Mammary Epithelial Cells and Breast Cancer Cells for IL-11 and Its Receptor
Figure 1
shows the intensity of staining for IL-11 and IL-11R in tumor and background tissues. The staining was poor in healthy mammary tissues (Fig. 1A), in contrast to breast cancer cells (Fig. 1B), which showed strong positive staining for IL-11. The staining intensity for IL-11 in healthy tissue was .0422 ± .018, compared with .107 ± .039 in tumor tissue (P = .00017).
Received for publication May 24, 2005.
Accepted for publication November 11, 2005.
TOP
ABSTRACT
INTRODUCTION
). High-grade tumors (grade 3) also showed a positive correlation with the expression of IL-11 (P = .005). 
