Annals of Surgical Oncology Sign the Guestbook
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/s10434-006-9289-0
Annals of Surgical Oncology 14:1092-1098 (2007)
© 2007 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadahiro, S.
Right arrow Articles by Murayama, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadahiro, S.
Right arrow Articles by Murayama, C.

Original Article

Detection of Carcinoembryonic Antigen Messenger RNA-Expressing Cells in Peripheral Blood 7 Days After Curative Surgery is a Novel Prognostic Factor in Colorectal Cancer

Sotaro Sadahiro, MD1, Toshiyuki Suzuki, MD1, Yuji Maeda, MD1, Satoshi Yurimoto, PhD1, Seiei Yasuda, MD1, Hiroyasu Makuuchi, MD1, Akemi Kamijo, BS1 and Chieko Murayama, PhD2

1 Department of Surgery, Tokai University School of Medicine, Bohseidai, Isehara, Kanagawa, Japan
2 Department of Clinical Pharmacology, Tokai University School of Medicine, Bohseidai, Isehara, Kanagawa, Japan

Correspondence: Address correspondence and reprint requests to: Sotaro Sada-hiro, MD, Department of Surgery, Tokai University, Bohseidai, Isehara, Kanagawa, 259-1193, Japan; E-mail: sadahiro{at}is.icc.u-tokai.ac.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: The significance of detection of circulating cancer cells in blood during surgery in patients with colorectal cancer (CRC) remains controversial. Experimental study revealed that the cancer cells injected from the vein disappeared completely until 7 days. The aim of this study was to clarify that the detection of circulating cancer cells in blood taken later than 7 days after curative surgery may be a prognostic factor.

Methods: Two hundred consecutive patients with CRC who underwent potentially curative surgery were the subjects. Peripheral blood was collected between 7 and 10 days after resection. Cancer cells were detected using reverse transcriptase-polymerase chain reaction targeting carcinoembryonic antigen (CEA) messenger RNA (mRNA). The median follow-up period was 52 months (range: 34–69 months).

Results: The overall positive incidence of CEA mRNA was 22%. Detection of CEA mRNA was not significantly related to conventional clinicopathological findings. Recurrence has been confirmed in 55 patients (28%). The recurrence rate was significantly higher in patients with rectal cancer, deep penetration, lymph node metastasis, preoperative chemoradiotherapy and positive CEA mRNA. The CEA mRNA positive patients showed significantly poorer disease free survival (DFS) and overall survival (OS) than the negative patients (DFS, P = 0.007; OS, P = 0.04). Multivariate analysis revealed that the positive expression of CEA mRNA (P < 0.01) as well as the tumor location and TNM stage classification was identified as the significant risk factors for recurrence.

Conclusions: Detection of CEA mRNA expressing cells in peripheral blood 7 days after curative surgery is a novel independent factor predicting recurrence in patients with CRC.

Key Words: Colorectal cancer • Carcinoembryonic antigen (CEA) • Circulating tumor cells • Reverse transcriptase-polymerase chain reaction (RT-PCR)


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Despite advances in surgical and adjuvant therapies, about 33–44% of patients with radically resected colorectal cancer have tumor relapse.1–3 In patients with relapse after curative resection, it is assumed that micrometastasis had been already formed at surgery and, with the proliferation of micrometastatic cancer cells, grew larger and became clinically evident in the postoperative course.4 Therefore, cancers relapsing after curative resection should be classified as stage IV, although actually classified as stage I, II or III at surgery. There is a need for more sensitive methods to detect small volume disease.

Reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect a very small quantity of disseminated tumor cells. This technique is more sensitive and quantitative to detect tumor cells in blood stream than traditional methods like cytology and immunohistochemistry. 5–9 Positive reaction of CEA mRNA in total mRNA isolated from all peripheral mononuclear cells would indicate the presence of tumor cells because CEA is not expressed by blood cells but tumor cells.7,8 There are many reports concerning circulating cancer cells in patients with colorectal cancer using RT-PCR targeting carcinoembryonic antigen (CEA) or cytokeratin mRNAs. The significance of detection of circulating cancer cells in the mesenteric and peripheral blood remains controversial.10–20 Almost all authors took blood samples before, during, or immediately after surgery.

Patel et al.21 took blood samples before and until 3 months after surgery and reported a significant decrease of the positive patients at 24 hours after surgery in Dukes A/B subgroup. Fidler et al. experimentally reported that cancer cells injected in peripheral vein of the mouse rapidly decreased with time and that they were detected until 3 days and not detected 7 days after injection.22 Based on these reports, we hypothesized that, to identify the residual micrometastasis in colorectal cancer patients who underwent potentially curative surgery, circulating cancer cells should be detected with blood samples taken after the influence of surgical manipulation disappeared. The aim of this study was to clarify that the detection of circulating cancer cells in blood taken later than 7 days after surgery may be a prognostic factor. So far, no report is available regarding the relation between the detection of cancer cells in peripheral blood taken later than 7 days after surgery and prognosis.


   PATIENTS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Patients
This study was performed on 200 consecutive patients with colorectal cancer who underwent potentially curative surgery at the Department of Surgery, Tokai University, between April 2000 and December 2002. According to TNM classification in the resected specimen, 55 were in stage I, 86 in stage II, and 55 in stage III. T category of 1 patient was unknown because of complete remission by preoperative chemoradiotherapy. N category of 3 patients was unknown because of local excision following chemoradiotherapy for low rectal cancer. Of these patients, 160 had colon cancer and 40 had rectal cancer. None of the patients were lost to follow-up with a median of 52 months (range: 34–69 months). This study was approved by the institutional review board of Tokai University School of Medicine and all patients gave informed consent.

Blood Sampling
Peripheral blood was collected between 7 and 10 days after resection when pathological TNM stage had been determined. To prevent contamination with epithelial cells, peripheral blood samples were obtained through a catheter inserted into the peripheral vessel. The first 10 ml was discarded to prevent contamination with epithelial cells.

Competitive Seminested RT-PCR Technique
Since details of our technical procedure were reported previously, we describe it briefly here.16 As described in our previous report, total RNA was isolated from peripheral blood mononuclear cells using an mRNA Isolation Kit (Roche Molecular Biochemicals, Penzberg, Germany) and redissolved in diethyl pyrocarbonate-treated water. Isolated mRNA was reverse-transcribed. In our semi-nested competitive PCR, a CEA competitor template was designed as follows. A 12 bp fragment was inserted between Nt. 2246 and 2247 of plasmid pCEA-WT containing 343 bp of CEA (Nt.1966–2308). PCR of the expanded clone yielded a band of 144 bp compared with a band of 132 bp using wild-type CEA as a template. CEA-specific oligonucleotide primers were synthesized as follows: primer A: 5'-TCTGG AACTTCTCCTGGTCTCTCAGCTGG–3', primer B: 5'-TGTAGCTGTTGCAAATGCTTTAAGGAA GAAGC–3' and primer C: 5'-FITC-GGGCCACT GTCGGCATCATGATTGG–3'. The first PCR was performed by using primers A and B with amplification of 30 cycles, and then this PCR product was applied for seminested PCR using primers B and C with amplification of 30 cycles. The integrity and the quantity of RNA for preparation of all cDNAs were analyzed by performance of the ß-actin competitive PCR as an internal control. A ß-actin competitor template was designed as described before. PCR was performed by using oligonucleotide-specific primers for ß-actin; 5'-CTTCTA-CAATGAGCTGCGTG–3' for sense primer and 5'-TCATGAGGTAGTCAGTCAGG–3' for antisense primer. Amplification was performed with 35 cycles. Each PCR procedure was performed under the same conditions as our previous reports. Amplification products were electrophoresed on an 8% polyacrylamide gel and quantified using FMBIO Fluorescence Image Analyzer (Hitachi Software Engineering, Yokohama, Japan). CEA mRNA/ß-actin mRNA ratio was used to determine relative CEA expression level. This technique can detect one CEA mRNA-expressing cancer cell in 1 x 105 normal lymphocytes.

Patients’ Follow-up
Patients visited the out-patients’ department every 3 months or more frequently for the initial 2 years, every 4–6 months for the next 2 years, and every 6–12 months thereafter. Evaluation consisted of medical history, physical examination, and laboratory studies, including blood cell count, liver function tests, and serum CEA. Abdominal computed tomography or ultrasonography, and chest X-ray were performed every 6 months. Barium enema or colonoscopy was performed 1 year after surgery and every 2–3 years thereafter. Examinations were performed at any time when patients were symptomatic.

Statistical Analysis
The primary endpoints were to evaluate if circulating tumor cells influenced patients’ disease-free survival (DFS) and overall survival (OS). DFS curves and OS curves were generated by the Kaplan–Meier method23 and compared by the log-rank test. Categorical variables were compared by the {chi}2 test or Mann–Whitney U test. Probability curves were calculated by using the Kaplan–Meier method, with the log-rank test used to compare the two groups. In order to identify the factors influencing DSF and OS, the Cox’s proportional hazard model (multivariate analysis) in a stepwise fashion was used.24 We selected four factors (PCR status, tumor location, TNM classification, and adjuvant chemotherapy) and input these variables into the multivariate analysis model. All data were analyzed by using the SPSS II software package for Windows (release 13.0; SPSS Japan Inc., Tokyo, Japan), with the level of significance set at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Detection of CEA mRNA in Blood and Clinicopathological Findings
The incidence of positive CEA mRNA in peripheral blood taken from 7 to 10 days after curative resection is shown in Table 1Go. The overall positive incidence in all patients was 22%. Detection of CEA mRNA was not significantly related to gender, tumor location, size of tumor, T classification (depth of tumor invasion), lymph node involvement, TNM stage, degree of differentiation or preoperative chemoradiotherapy.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Incidence of CEA mRNA positive reaction
 
Recurrence
During the median follow-up of 52 months (range: 34–69 months), 55 patients (28%) had recurrence. Out of 55 patients with recurrence, 33 died and 22 are alive with cancer. The other 7 died of other diseases (2 of pneumonia, 2 of cerebral infarction, each 1 of acute heart failure, liver cirrhosis, and esophageal cancer). Table 2Go shows the relationship of the recurrence rate to clinicopathological findings and to the incidence of CEA mRNA detection. The recurrence rate was significantly higher in patients with rectal cancer, deep penetration, lymph node metastasis, preoperative chemoradiotherapy, and positive CEA mRNA. The recurrence rates in CEA mRNA positive patients were 3/9 (33%) in stage I, 7/20(35%) in stage II, and 10/15 (67%) in stage III. The recurrence rates in CEA mRNA negative patients were 2/47 (4%), 14/ 67 (21%), and 19/40 (48%), respectively. Recurrence in stage I was significantly higher in the positive patients (P = 0.03; Fig. 1Go).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Relationship of the recurrence to clinicopathological findings and to the incidence of CEA mRNA positive reaction
 

Figure 1
View larger version (8K):
[in this window]
[in a new window]

  		FIG. 1. The recurrence rate in each TNM stage by CEA mRNA status.

 
The incidences of CEA mRNA positive reaction according to the recurrence site were 5 of 16 patients (31%) with liver metastasis, 3 of 12 patients (25%) with locoregional recurrence, 4 of 11 patients (36%) with lung metastasis, 2 of 6 patients (33%) with metastasis to the peritoneum, and 3 of 5 patients (60%) with lymph node metastasis. There was no relationship between the site of recurrence and CEA mRNA detection in blood.

Recurrence was observed in 20 patients out of 44 CEA mRNA positive patients. The CEA mRNA expression level was 25.3 ± 42.7 x 10–8/ß-actin in patients with recurrence and 17.0 ± 12.710–8/ß-actin in patients without recurrence. There was no significant difference between them.

DFS and OS
DFS and OS in CEA mRNA positive and negative patients are shown in Fig. 2a and bGo, respectively. The CEA mRNA positive patients showed significantly poorer DFS and OS than the negative patients (DFS, P = 0.007; OS, P = 0.04). DFS and OS in colon cancer and rectal cancer, and those in TNM stages are shown in Fig. 3a and bGo, and in Fig. 4a and bGo, respectively. Colon cancer showed significant better DFS than rectal cancer; however, there was no significant difference in OS between colon cancer and rectal cancer. (DFS, P = 0.04; OS, P = 0.68) TNM stage I and II showed significant better DFS and OS than stage III (DFS, stage I vs. III P < 0.0001, II vs. III P < 0.0001; OS, stage I vs. III P < 0.0001, II vs. III P < 0.0001); however, there was no significant difference in DFS and OS between stage I and II.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 2. a DFS curves according to the presence or absence of circulating tumor cells in peripheral blood. b OS curves according to the presence or absence of circulating tumor cells in peripheral blood.

 

Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 3. a DFS curves according to the tumor site; b OS curves according to the tumor site.

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 4. a DFS curves according to TNM stages; b OS curve according to the TNM stages.

 
Multivariate Analysis
The results of the multivariate analysis are shown in Table 3Go. Positive expression of CEA mRNA (relative risk 2.29, P = 0.004), colon cancer (relative risk 0.37, P = 0.001), TNM stage II (relative risk 3.34 vs. stage I, P = 0.020), and TNM stage III (relative risk 9.40 vs. stage I, P < 0.001) was identified as significant risk factors influencing tumor recurrence. While, TNM stage III (relative risk 8.82 vs. stage I, P < 0.001) and adjuvant chemotherapy (relative risk 0.41, P = 0.009) were selected as factors independently associated with survival; however, P value of CEA mRNA status was not significant.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Risks influencing disease recurrence and survival by multivariate analysis
 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Many authors reported that both portal and peripheral blood taken immediately after mobilizing the tumor-bearing bowel during surgery were tumor cell positive at higher percentages.12,13,17,25–27 These results suggested that tumor manipulation during surgery causes tumor cell shedding. Because the detection of circulating tumor cells in blood samples taken during surgery is unstable, it is suggested not appropriate to predict the prognosis after curative resection based on these detection results. From the previous reports, the significance of detection of circulating cancer cells taken during surgery as a prognostic factor remains controversial.10–20

Patel et al. reported that, in Dukes A/B patients, circulating tumor cells were significantly less detected in peripheral blood at 24 hours after surgery than before surgery.21 However, Bessa et al. showed no relationship between circulating tumor cells in peripheral blood taken 24 hours after curative resection to DFS or OS.18 In some patients diagnosed with stage I, II or III, circulating cancer cells shed from the occult residual micrometastasis should be detected if we took blood samples after many cancer cells temporarily shed from the resected primary tumor during surgery completely disappeared. Fidler et al. injected iodine-125-labeled B16 melanoma cells from the tail vein in mice and reported that 0.3% of injected cells were detected after 24 hours and that the labeled cells were detected until 3 days and not detected 7 days after injection.22 Based on these results, in the present study, blood samples taken from 7 to 10 days after potentially curative resection were used to detect CEA mRNA.

As a result, the recurrence rate was significantly higher and DFS was poorer in the CEA mRNA positive patients. The results of the multivariate analysis identified CEA mRNA expression as well as TNM stage and tumor location as factors influencing DFS. On the contrary, CEA mRNA was not identified as a factor influencing the survival. This will be because the number of events (deaths) was not many and because the survival period depends upon the treatment after recurrence.

We previously reported that circulating cancer cells were detected in peripheral blood from early stage in colorectal cancer and that the difference in mRNA expression was not significant between portal and peripheral blood.16 Koch et al. described that the filter function of the liver in "cascade therapy" was limited.27 They further suggest, based on their study, the appropriateness of using peripheral blood instead of blood from the mesenteric vein, the drainage vein, to detect small numbers of circulating cancer cells released from the micrometastasis.

According to our results, the CEA mRNA expression level does not seem to be related to tumor recurrence because we could not find any differences in the expression level of CEA mRNA between recurrent patients and nonrecurrent patients.

Zhang et al. reported multiple blood sampling increased the detection of tumor cells in peripheral blood in colorectal cancer patients.28 Blood samples were taken only once in the present study at 7–10 days following potentially curative surgery. Sensitivity may increase by increasing the frequency of blood sampling.

The current staging method which has been widely used in the world, UICC TNM-stage, is mainly based on depth of tumor penetration and lymph node involvement in the resected specimen.29 We demonstrated in the present study that the detection of circulating cancer cells in peripheral blood at 7–10 days after surgery was associated with the significantly increased risk of recurrence. The recurrence rate in stage I was significantly higher in CEA mRNA positive patients compared to negative patients (P = 0.03). CEA mRNA expression in peripheral blood may be a factor identifying high-risk patients among the stage I population for whom chemotherapy is not currently indicated.

In conclusion, the detection of circulating cancer cells in blood taken later than 7 days after curative surgery is a significant independent prognostic factor in patients with colorectal cancer.

Received for publication September 3, 2006. Accepted for publication November 9, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Safi F, Beyer HG. The value of follow-up after curative surgery of colorectal carcinoma. Cancer Detect Prev 1993; 17:417–424.[Medline]
  2. Castells A, Essa X, Daniels M, et al. Value of postoperative surveillance after radical surgery for colorectal cancer: Results of a cohort study. Dis Colon Rectum 1998; 41:714–724.[CrossRef][Medline]
  3. Goldberg RM, Fleming TR, Tangen CM, et al. Surgery for recurrent colon cancer: Strategies for identifying resectable recurrence and success rates after resection. Ann Intern Med 1998; 129:27–35.
  4. Sadahiro S, Suzuki T, Ishikawa K, et al. Estimation of the time of pulmonary metastasis in colorectal cancer patients with isolated synchronous liver metastasis. Jpn J Clin Oncol 2005; 35:18–22.[Abstract/Free Full Text]
  5. Gerhard M, Juhl H, Kalthoff H, Schreiber HW, Wagener C, Neumaier M. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994; 12:725–729.[Abstract]
  6. Burchill SA, Bradbury MF, Pittman K, Southgate J, Smith B, Selby P. Detection of epithelial cancer cells in peripheral blood by reverse transcriptase-polymerase chain reaction. Br J Cancer 1995; 71:278–281.[Medline]
  7. Jonas S, Windeatt S, Boateng AO, Fordy C, Allen-Mersh TG. Identification of carcinoembryonic antigen producing cells circulating in the blood of patients with colorectal carcinoma by reverse transcriptase chain reaction. Gut 1996; 39:717–721.[Abstract/Free Full Text]
  8. Mori M, Mimori K, Ueno H, et al. Clinical significance of molecular detection of carcinoma cells in lymph nodes and peripheral blood by reverse transcription-polymerase chain reaction in patients with gastrointestinal or breast carcinomas. J Clin Oncol 1998; 16:128–132.[Abstract/Free Full Text]
  9. Weitz J, Kienle P, Lacroix J, et al. Dissemination of tumor cells in patients undergoing surgery for colorectal cancer. Clin Cancer Res 1998; 4:343–348.[Abstract/Free Full Text]
  10. Guller U, Zajac P, Schnider A, et al. Disseminated single tumor cells as detected by real-time quantitative polymerase chain reaction represent a prognostic factor in patients undergoing surgery for colorectal cancer. Ann Surg 2002; 236:768–776.[CrossRef][Medline]
  11. Taniguchi T, Makino M, Suzuki K, Kaibara N. Prognostic significance of reverse transcriptase-polymerase chain reaction measurement of carcinoembryonic antigen mRNA levels in tumor drainage blood and peripheral blood of patients with colorectal carcinoma. Cancer 2000; 89:970–976.[CrossRef][Medline]
  12. Weitz J, Koch M, Kienle P, et al. Detection of hematogenic tumor cell dissemination in patients undergoing resection of liver metastases of colorectal cancer. Ann Surg 2000; 232:66–72.[CrossRef][Medline]
  13. Yamaguchi K, Takagi Y, Aoki S, Futamura M, Saji S. Significant detection of circulating cancer cells in the blood by reverse transcriptase-polymerase chain reaction during colo-rectal cancer resection. Ann Surg 2000; 232:58–65.[CrossRef][Medline]
  14. Bessa X, Elizalde JI, Boix L, et al. Lack of prognostic influence of circulating tumor cells in peripheral blood of patients with colorectal cancer. Gastroenterol 2001; 120:1084–1092.[CrossRef][Medline]
  15. Fujita S, Kudo N, Akasu T, Moriya Y. Detection of cyto-keratin 19 and 20 mRNA in peripheral and mesenteric blood from colorectal cancer patients and their prognosis. Int J Colorectal Dis 2001; 16:141–146.[CrossRef][Medline]
  16. Sadahiro S, Suzuki T, Tokunaga N, et al. Detection of tumor cells in the portal and peripheral blood of patients with colo-rectal carcinoma using competitive reverse transcriptase-polymerase chain reaction. Cancer 2001; 92:1251–1258.[CrossRef][Medline]
  17. Ito S, Nakanishi H, Hirai T, et al. Quantitative detection of CEA expressing free tumor cells in the peripheral blood of colorectal cancer patients during surgery with real-time RT-PCR on a LightCycler. Cancer Lett 2002; 183:195–203.[CrossRef][Medline]
  18. Bessa X, Pinol V, Castellvi-Bel S, et al. Prognostic value of postoperative detection of blood circulating tumor cells in patients with colorectal cancer operated on for cure. Ann Surg 2003; 237:368–375.[CrossRef][Medline]
  19. Vlems FA, Diepstra JHS, Cornelissen IMHA, et al. Limitations of cytokeratin 20 RT-PCR to detect dissemination tumour cells in blood and bone marrow of patients with colorectal cancer: expression in controls and downregulation in tumour tissue. J Clin Pathol Mol Pathol 2002; 55:156–163.[Abstract/Free Full Text]
  20. Sadahiro S, Suzuki T, Ishikawa K, et al. Detection of carcinoembryonic antigen messenger RNA-expressing cells in portal and peripheral blood during surgery does not influence relapse in colorectal cancer. Ann Surg Oncol 2005; 12:988–994.[Abstract/Free Full Text]
  21. Patel H, Marer NL, Wharton RQ, et al. Clearance of circulating tumor cells after excision of primary colorectal cancer. Ann Surg 2002; 235:226–231.[CrossRef][Medline]
  22. Fidler IJ. Metastasis: Quantitative analysis of distribution and fate of tumor emboli labeled with 125 I-5-iodo-2'-deoxyuridine. J Natl Cancer Inst 1970; 45:773–782.[Medline]
  23. Kaplan EL, Meier P. Nonparametric estimation of incomplete observations. J Am Stat Assoc 1958; 53:457–481.[CrossRef]
  24. Cox DR. Regression models and life tables. J R Stat Soc Br 1972; 34:187–220.
  25. Tien YW, Lee PH, Wang SM, Hsu SM, Chang KJ.. Simultaneous detection of colonic epithelial cells in portal venous and peripheral blood during colorectal cancer surgery. Dis Colon Rectum 2002; 45:23–29.[CrossRef][Medline]
  26. Miyazono F, Natsugoe S, Takao S, et al. Surgical maneuvers enhance molecular detection of circulating tumor cells during gastric cancer surgery. Ann Surg 2001; 233:189–194.[CrossRef][Medline]
  27. Koch M, Weitz J, Kienle P, et al. Comparative analysis of tumor cell dissemination in mesenteric, central, and peripheral venous blood in patients with colorectal cancer. Arch Surg 2001; 136:85–89.[Abstract/Free Full Text]
  28. Zhang XW, Yang HY, Fan P, Yang L, Chen GY. Detection of micrometastasis in peripheral blood by multi-sampling in patients with colorectal cancer. World J Gastroenterol 2005; 11:436–438.[Medline]
  29. Greene FL, Balch CM, Fleming ID, et al. (eds). (2002) AJCC manual for staging of cancer, 6th edn. Berlin Heidelberg New York:Springer.



This article has been cited by other articles:


Home page
 Ann. Surg. Oncol.Home page
Y.-H. Uen, C.-Y. Lu, H.-L. Tsai, F.-J. Yu, M.-Y. Huang, T.-L. Cheng, S.-R. Lin, and J.-Y. Wang
Persistent Presence of Postoperative Circulating Tumor Cells is a Poor Prognostic Factor for Patients with Stage I-III Colorectal Cancer after Curative Resection
Ann. Surg. Oncol., August 1, 2008; 15(8): 2120 - 2128.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadahiro, S.
Right arrow Articles by Murayama, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadahiro, S.
Right arrow Articles by Murayama, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS