Annals of Surgical Oncology Sign the Guestbook
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/s10434-006-9064-2
Annals of Surgical Oncology 14:1670-1677 (2007)
© 2007 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mimori, K.
Right arrow Articles by Mori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mimori, K.
Right arrow Articles by Mori, M.

Original Article

Loss of MAL Expression in Precancerous Lesions of the Esophagus

Koshi Mimori, MD, PhD1, Kohjiro Nishida, MD1, Yoshito Nakamura, MD1, Keisuke Ieta, MD2, Yasuji Yoshikawa, MD, PhD2, Atsushi Sasaki, MD, PhD1, Hideshi Ishii, MD, PhD3, Miguel A. Alonso, MD4 and Masaki Mori, MD, PhD, FACS1

1 Department of Surgical Oncology, Medical Institute of Bioregulation, Kyushu University, 4546 Tsurumihara, Beppu, 874-0838, Japan
2 Department of Pathology, Medical Institute of Bioregulation, Kyushu University, 4546 Tsurumihara, Beppu, 874-0838, Japan
3 Division of Stem Cell Regulation/Molecular Hematopoiesis, Jichi Medical School, Center for Molecular Medicine, Yakushiji 3311-1, Minami Kawauchi-Cho, Kawachi-Gun, 329-0498, Japan
4 Centro de Biologia Molecular "Severo Ochoa," Faculatad de Ciencias, Universidad Autónoma de Madrid, Cantoblanco, Madrid, 28049, Spain

Correspondence: Address correspondence and reprint requests to: Masaki Mori, MD, PhD, FACS; E-mail: mmori{at}beppu.kyushu-u.ac.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: We have identified a novel function of MAL (T-cell differentiation-related gene) as a candidate suppressor gene in esophageal cancer. As the role of MAL expression in esophageal carcinogenesis is as yet undetermined, MAL expression in a rat multi-step carcinogenic model and in precancerous lesions of the human esophagus was investigated. Microarray analysis between MAL-transfectant and control cells was also carried out to clarify how MAL confers its anti-tumor effects.

Materials and Methods: (1) In the rat model, MAL expression levels in laser microdissected normal esophageal epithelium, dysplastic tissues and carcinoma tissues were examined by reverse transcription (RT)-PCR. (2) Immunostaining with MAL antibody was performed in 10 dysplastic lesions adjacent to cancer in six cases of esophageal cancer. (3) We established a MAL transfectant using a Tet-off vector in esophageal cancer cells and performed microarray analysis under MAL-positive and MAL-negative conditions.

Results: (1) In the rat model, MAL mRNA expression was observed only in the normal samples. (2) MAL expression was observed distinctively in differentiated or keratinized normal tissues and was not observed in either dysplastic lesions or carcinoma tissue. (3) Up-regulated genes in MAL-positive cells included keratin 18 (transfectant/control = 2.94) and keratin 10 (t/c = 2.82).

Conclusion: MAL expression was lost in dysplastic lesions of the rat carcinoma model as well as the human esophagus. The up-regulated keratins revealed by microarray analysis and the strong staining of the differentiated normal tissues in immunohistochemical study support the role of MAL as a regulator of differentiation in esophageal epithelium.

Key Words: MAL • Esophageal cancer • Dysplasia • Differentiation • Keratin


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In a previous study, we isolated MAL (T-lymphocyte maturation-associated protein1,2 using a differential display assay and demonstrated that esophageal cancer tissues expressed lower levels of MAL than normal esophageal epithelium.3 Growth of a xenograft tumor from a MAL gene-transfected esophageal cancer cell line was suppressed remarkably compared to a non-MAL-expressing esophageal cancer cell line, implying that MAL may be a candidate cancer suppressor gene. With respect to the role of MAL in the natural history of cancer progression, we showed that MAL reduced tumorigenicity in vivo by the induction of apoptosis via the Fas signaling pathway.

We have also examined the clinical significance of MAL repression in 39 cases of advanced esophageal cancer and found no significant correlation between MAL expression and any known clinicopathologic variables. As loss of MAL expression was observed in almost all advanced esophageal cancer cases, suggesting that diminished MAL expression may be strongly associated with the oncogenic process rather than the advanced progression of carcinoma. In the study reported here, we focused on whether MAL expression is altered in pre-cancerous lesions.

In order to examine MAL expression in the pre-cancerous lesion, we utilized an established multi-step carcinogenic rat model for esophageal cancer.4,5 After microdissection of the target cells at each step, we extracted total RNA and transcribed it into cDNA.5 Even though our multi-step esophageal cancer model has been established by chemical antigens, such cancers are artificial and so there might be discrepancies between the rat model and human esophageal cancer. On the basis of the microarray analysis of the rat model, we identified the overexpression of cyclin D1,6,7 the abundant expression of Mdm2,8 and the diminished expression of the APC gene.9,10 These genes have already been recognized in human esophageal cancer cases and have also been identified in a second animal model.11 Therefore, our rat model seems to be acceptable as a corresponding model to human esophageal carcinoma.

In addition, we examined MAL expression in human dysplastic lesions adjacent to cancer sites, in normal epithelial tissue and in cancerous tissue by immunohistochemical (IHC) staining of these tissues obtained from six esophageal cancer patients. According to a previous study by Marazyela et al.,12 MAL plays a role in clathrin-mediated endocytosis from the apical surface, and positive staining has been observed in esophageal epithelium.13 However, there is little information about MAL expression in dysplastic lesions of the esophagus.

Furthermore, to increase understanding of the functions of the MAL gene in human esophageal cancer, in addition to its known functions such as T-cell differentiation and the transport of water-soluble molecules and ions across the lipid bilayer 2, we analyzed the expression profile of genes in a MAL-transfected esophageal cancer cell line and compared this to the expression profile of a control, mock-transfected cell line.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Preparation of mRNA from Rat Model Animals
In brief, 4-week-old male Wistar rats were allowed free access to water for 7 days prior to commencing the experiments, as described previously.5 Final concentrations of 0.003% AMN and 0.1 g/ml tissue polypeptide antigen (TPA) were administrated to the rats as follows: 6 rats were administered AMN: N-amyl-N-methylnitrosamine for 6 weeks, followed by TPA:12-O-tetradecanoylphorbol-13-acetate administration for 8 weeks.

All rats were observed for 20 weeks from the beginning of treatment and were sacrificed at the end of the experiment. Tissues from normal esophageal epithelium, papilloma, dysplasia and carcinoma were cut into two equal pieces, with one piece being used for the pathological diagnosis and the other being used for the reverse transcription (RT)-PCR analysis. The diagnosis for papilloma or dysplasia was made according to the method used in our previous studies.5,14 We used a lasermicrodissection system (Leica Microsystems, Wetzlar, Germany), and total RNA was extracted from each sample of laser-microdissected cells as described in our previous studies.15,16

Quantitative Expression of MAL Gene
The sequence of one clone detected only in normal esophageal tissue was identical to the human MAL cDNA sequence (GenBank accession no. M15800). The expression level of the MAL gene amplicon was evaluated by quantitative real-time RT-PCR with a Lightcycler3 (Roche, Tokyo Japan).

Esophageal Cancer Cases and Tissues
Six Japanese esophageal cancer patients were recruited for the IHC study with documented informed consent after adequate explanation of the study procedure. All patients underwent surgery at the Department of Surgery, Medical Institute of Bioregulation, Kyushu University, Beppu, Japan. The patient cohort consisted of four male and two female patients with an average age of 65 years (range: 54–72 years). Based on the TNM classification of malignant tumors, four patients had stage III tumor, one had stage II tumor, and one patient had lung metastasis (stage IV). With respect to pathology, five cases were moderately differentiated squamous cell carcinoma, and the other case was poorly differentiated squamous cell carcinoma. Among the six patients taking part in this study, mild dysplasia or intermediate dysplasia was observed in a total of ten lesions, and carcinoma tissue was recognized in six tumors. The highest grade of dysplasia is squamous cell carcinoma in situ or intraepithelial carcinoma; however, we excluded patients with severe dysplasia from this study.

Immunohistochemistry for MAL Expression
Anti-MAL monoclonal antibody was provided by Miguel A. Alonso (Centro de Biologia Molecular "Severo Ochoa," Universidad Autonoma de Madrid and Consejo Superior de Investigaciones Cientificas, Cantoblanco, Madrid, Spain). In brief, deparaffinization was performed on slides at room temperature. An internal peroxidase blocking agent was gently dropped onto the specimens for 10 min, following which the slides were rinsed with distilled water. The antibody was diluted 200x in buffer (DakoCytomation EnVision+ Dual Link/HRP; Code No. K4063, Dako Japan, Tokyo) and dropped onto the specimens for 45 min. The specimens were then rinsed with TBS, exposed using the EnVision kit, and evaluated for MAL expression. To confirm the test for the non-specific staining of the antibody, we compared data on the immunostaining pattern of the antibody serum with that of the second serum alone in five representative esophageal cancer cases.

cDNA Microarray for MAL-Transfectant and Mock-Transfectant Cells
In a previous study we established a MAL gene-transfected esophageal cancer cell line, TE3. The 511-bp full-length amplified MAL gene product was purified, cut with EcoRI and HindIII, and ligated into the respective EcoRI and HindIII sites on the response vector pTRE2 (Clontech Laboratories, Palo Alto, CA). Subsequent to the transfection of the regulatory plasmid pTet-Off into TE3 cells and clone selection, the MAL-pTRE2 plasmid was transfected into clones carrying pTet-Off using Lipofectamine (Life Technologies, Rockville, MD). In order to detect MAL-associated genes in esophageal cancer, we performed microarray analysis with 3.0 µ g of MAL-pTRE2 with doxycycline and MAL-pTRE2 without doxycycline (DOX).3 Aliquots of mRNA (3.0 µ g each) from MAL-pTRE2 without DOX (MAL+) and mRNA from MAL-pTRE2 with DOX (MAL– ) were labeled with Cy5-dCTP and Cy3-dCTP (Amersham Biosciences, UK), respectively. Labeled probes were hybridized with 624 genes on Takara Human Cancer CHIP Version 2.0 (Takara, Japan) in hybridization buffer (Takara, Japan) for 14–16 h at 65° C. Following hybridization, the slides were washed twice in 2 x SSC/0.2% sodium dodecyl sulfate (SDS) for 30 min at 55° C and 2 x SSC/0.2% SDS for 30 min at 65° C, then in 0.05 x SSC for 5 min at room temperature. Scanning of the slides was performed immediately thereafter using a GMS418 Array Scanner (Genetic Microsystems, Tokyo, Japan). The intensity of each hybridization signal was evaluated by ImaGene version 3.0 software, and normalization of expression was performed with housekeeping genes on the CHIP.

Validation of Microarray Analysis by Real-Time RT-PCR
We confirmed the microarray analysis data by real-time RT-PCR with the following primers: neurotrophic Neurotrophic tyrosine kinase, receptor, type 2 (NTRK-2): forward AGCATGAGCACATCGTC-AAG, reverse ATATGCAGCATCTGCGACTG; keratin 18: forward CACAGTCTGCTGAGGTTG-GA, reverse GAGCTGCTCCATCTGTAGGG; keratin 10: forward CATCCTGCTTCAGATCGACA, reverse TCATTTCCTCCTCGTGGTTC; caspase-6: forward CTGCTGGAGCTGACTTCCTC, reverse AATTGCACTTGGGTCTTTGC; bone morphogenetic protein 7 (BMP-7): forward GGTCATGAG-CTTCGTCAACC, reverse GCAGGAGAGATC CGATTCC. We also applied amplified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward TTGGTATCGTGGAAGGACTCTA and reverse TGTCATATTTGGCAGGTT) as an internal control.17 Gene expression levels of those genes were adjusted to that of GAPDH and were calculated by using NIH Image ver.1.62 software.17


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of MAL in the Rat Multi-Step Model for Esophageal Cancer
We established papilloma, dysplasia, and carcinoma lesions in a rat multi-step carcinogenic model for esophageal cancer and extracted mRNA in order to synthesize cDNA for each tissue. Figure 1Go shows the expression of MAL in all three lesions of normal esophageal tissue in the rat model. We were unable to detect any signal in any of the dysplastic, papilloma, or carcinoma tissues.


Figure 1
View larger version (261K):
[in this window]
[in a new window]

  		FIG. 1. Established multi-step carcinogenic model of rat esophagus and the expression of the T-lymphocyte maturation-associated protein (MAL) gene in rat esophageal tissues with various histology. A representative part of resected specimens and that with a pathological diagnosis in a multi-step carcinogenesis model of rat are shown. From six rats administered with 0.003% AMN for 6 weeks followed by 0.1 g/ml TPA for 8 weeks, we extracted normal esophageal tissue, dysplastic tissue, papilloma tissue, and carcinoma tissue. We then examined MAL mRNA expression in cDNA synthesized from each type of tissue.

 
MAL Expression in Human Esophageal Epithelium (Fig. 2Go)
After verification that non-specific staining of the MAL antibody in all five representative cases had been avoided, we utilized the antibody for subsequent experiments. In the normal esophageal epithelium, the membrane of the squamous cell layer was strongly stained, and one layer of the basement membrane of the epithelium did not show any staining with the anti-MAL antibody. The mild grades of dysplasia showed a larger component of mature-appearing squamous cells, some of which may be keratinized, and the abnormal cells were often limited to the lower half of the epithelium. However, there was no MAL expression in the lower half of the epithelium. The intermediate-grade dysplasia showed cellular crowding and nuclear pleomorphism involving the basal two-thirds of the epithelium. MAL expression was also not observed in intermediate-grade dysplasia. It is worth noting that the keratinized or differentiated cells were mainly stained with MAL antibody; therefore, a few lesions in cancer tissues with keratinized portions exhibited positive expression of MAL.


Figure 2
View larger version (278K):
[in this window]
[in a new window]

  		FIG. 2. MAL expression in various human esophageal epithelium samples (left: hematoxylineosin staining; right: MAL staining. x100) We verified that the applied MAL antibody did not stain non-specifically (top left: serum alone without the MAL antibody; top right: serum with MAL antibody). MAL expression was observed in the differentiated or keratinized parts of tissues. There was no MAL staining in the basal cell layer of the esophageal epithelium, nor in the dysplastic lesions. The bottom figure clearly demonstrates the difference in MAL staining between normal epithelium and carcinoma lesion in a single section.

 
As shown in Table 1Go, the positive rate for MAL expression was significantly higher in normal epithelial cells (55/55, 100%) than in dysplastic lesions (0/10) (P < 0.05). We also observed a significant difference between normal epithelial cells and carcinoma cells (0/6 tumors) in the MAL-positive rate. Therefore, MAL expression is apparently reduced in dysplasia of the esophageal epithelium.


View this table:
[in this window]
[in a new window]

  		TABLE 1. MAL expression in normal epithelium, dysplasia, and carcinoma of the esophagus
 
Identification of MAL Expression-Associated Genes in Esophageal Cancer
The expression ratio of genes in MAL-expressing cells to those in non-MAL-expressing cells ranged from 3.11 to 0.10 (average: 0.96). Among the listed genes, keratins 18, 10, and 8 were overexpressed in MAL-transfected cells.

Previous studies have reported that these three keratins show anti-tumor effects;18–21 however, they are cleaved by caspase activity.21,22

In the MAL-overexpressing cells, neurotrophic tyrosine kinase receptor23 showed the highest expression level (Table 2Go). In addition, IHC staining revealed that the nerve fibers in the esophageal tissues exhibited a strong expression of MAL; therefore, it is feasible that neurotrophic tyrosine kinase receptor was listed-up to the first place in Table 2Go. Caspase-6 is recognized as an apoptosis-related gene,24,25 so we would expect that MAL may exert anti-tumor activity together with caspase activity. Further study is required to determine the relationship between MAL and caspase-6.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Genes overexpressed especially in the MAL transfectant
 
We confirmed expression of those representative genes, such as NTRK-2, keratin 18, keratin 10, caspase 6, and BMP-7, in both MAL-expressing and non-MAL-expressing cells. These genes were more highly expressed in the former cells than in the latter (Fig. 3Go).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 3. Confirmation of the microarray analysis by real-time RT-PCR analysis. In order to validate the results of the microarray analysis, we performed a real-time RT-PCR assay. NTRK 2, keratin 18, keratin 10, caspase 6, and BMP 7 were more highly expressed in MAL-expressing cells (without doxycycline administration) than in non-MAL-expressing cells (with doxycycline). The expression ratio was adjusted to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level and was calculated using NIH Image ver. 1.62 software.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
According to Marazuela et al., MAL can be detected strongly and clearly by IHC in human esophageal epithelium.12 The most intriguing finding of the present investigation was that MAL expression was observed distinctly in differentiated lesions of the esophageal epithelium, even though it was not expressed in the basal cell layer of normal esophageal epithelium. Furthermore, we have a case in which a small keratinized lesion on top of the advanced cancer stained clearly with MAL antibody. Therefore, we hypothesize that MAL plays a role in the normal differentiation or keratinization of esophageal squamous cells. MAL may be required for keratin to mature and differentiate from the basal cell layer to the upper layer. Indeed, MAL was initially isolated as a molecule related to T-cell differentiation; it is therefore feasible that MAL contributes to the differentiation of epithelial cells as well.

The microarray analysis revealed that three keratin genes were up-regulated in MAL-expressing cells compared to control cells: keratins 18, 10, and 8. It is believed that keratins may contribute to the differentiation of squamous cells in the esophageal epithelium.26,27 In addition to the differentiation of epithelial tissues, these keratins may be involved in the MAL-mediated anti-tumor effect on cancer. Buhler et al. reported that forced expression of keratin 18 caused differentiation of breast cancer cells and thus prevented malignant transformation.18 Santos et al. reported that the forced expression of keratin 10 was associated with the inhibition of malignant development in transgenic mouse skin carcinomas20 and that the loss of keratin 10 activated the mitogen-activated protein kinase (MAPK) pathway in mice.19 Finally, Schutte et al. reported that both keratin 8 and keratin 18 were associated with apoptosis.21 Considering all the evidence, we suggest that MAL may contribute to normal differentiation processed and also may inhibit the growth of neoplastic cells in the esophageal epithelium via overexpression of keratins 18, 10, and 8.

This study touches upon the controversial issues relating to the mode of growth or expansion of esophageal cancer cells. MAL expression was not found in either the epithelial cells of the basal cell layer of the esophagus or in carcinoma cells. Therefore, we speculate that esophageal tumors may be derived from the basal cell layer of esophageal epithelial tissue, as described by the "bottom-up" theory by Preston et al.28 These authors contend that colorectal adenomas originate from the bottom of the epithelium, in opposition to the "top-down" theory of Shih et al.29

In conclusion, we have determined that MAL expression was reduced in pre-cancerous lesions in a rat multi-step carcinogenic model as well as in dysplastic lesions of esophageal cancer cases. MAL expression can be a negative marker for dysplastic cells without the ability to differentiate or keratinize in the esophageal epithelium. Based on the results of the microarray analysis, MAL transfection exerted an anti-tumor effect with differentiation of the esophageal epithelium.


   ACKNOWLEDGMENTS
 
We thank Ms. M. Oda and Ms. T. Shimooka for their technical support and Dr. K. Obara for his advice for the regarding pathological information. We also appreciate the cooperation of Drs. Kosaka and Motoyama. Financial support: This work was supported by the following grant sponsors: CREST; Japan Science and Technology Agency (JST); Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research (Grant nos. 17109013, 17591411, 17591413, and 17015032).


   FOOTNOTES
 
This investigation was presented on March 25, 2006 at the 59th Annual Meeting of the Society of Surgical Oncology at the San Diego Marriott Hotel, San Diego, California.

Received for publication July 5, 2006. Accepted for publication July 6, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alonso MA, Barton DE, Francke U. Assignment of the T-cell differentiation gene MAL to human chromosome 2, region cenq13. Immunogenetics 1988; 27:91–95.[CrossRef][Medline]
  2. Alonso MA, Weissman SM. cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation. Proc Natl Acad Sci USA 1987; 84:1997–2001.[Abstract/Free Full Text]
  3. Mimori K, Shiraishi T, Mashino K, et al. MAL gene expression in esophageal cancer suppresses motility, invasion and tumorigenicity and enhances apoptosis through the Fas pathway. Oncogene 2003; 22:3463–3471.[CrossRef][Medline]
  4. Matsufuji H, Ueo H, Mori M, Kuwano H, Sugimachi K. Enhancement of esophageal carcinogenesis induced in rats by N-amyl-N-methylnitrosamine in the presence of 12-O-tetra-decanoylphorbol-13-acetate. J Natl Cancer Inst 1987; 79:1123–1129.[Medline]
  5. Nishida K, Mine S, Utsunomiya T, et al. Global analysis of altered gene expressions during the process of esophageal squamous cell carcinogenesis in the rat: a study combined with a laser microdissection and a cDNA microarray. Cancer Res 2005; 65:401–409.[Abstract/Free Full Text]
  6. Jiang W, Kahn SM, Tomita N, Zhang YJ, Lu SH, Weinstein IB. Amplification and expression of the human cyclin D gene in esophageal cancer. Cancer Res 1992; 52:2980–2983.[Abstract/Free Full Text]
  7. Naitoh H, Shibata J, Kawaguchi A, Kodama M, Hattori T. Overexpression and localization of cyclin D1 mRNA and antigen in esophageal cancer. Am J Pathol 1995; 146:1161–9.[Abstract]
  8. Itoshima T, Fujiwara T, Waku T, et al. Induction of apoptosis in human esophageal cancer cells by sequential transfer of the wild-type p53 and E2F-1 genes: involvement of p53 accumulation via ARF-mediated MDM2 down-regulation. Clin Cancer Res 2000; 6:2851–2859.[Abstract/Free Full Text]
  9. Boynton RF, Blount PL, Yin J, et al. Loss of heterozygosity involving the APC and MCC genetic loci occurs in the majority of human esophageal cancers. Proc Natl Acad Sci USA 1992; 89:3385–3388.[Abstract/Free Full Text]
  10. Powell SM, Papadopoulos N, Kinzler KW, Smolinski KN, Meltzer SJ. APC gene mutations in the mutation cluster region are rare in esophageal cancers. Gastroenterology 1994; 107:1759–1763.[Medline]
  11. Goessel G, Quante M, Hahn WC, et al. Creating oral squamous cancer cells: a cellular model of oral-esophageal carcinogenesis. Proc Natl Acad Sci USA 2005; 102:15599–15604.[Abstract/Free Full Text]
  12. Marazuela M, Alonso MA. Expression of MAL and MAL2, two elements of the protein machinery for raft-mediated transport, in normal and neoplastic human tissue. Histol Histopathol 2004; 19:925–933.[Medline]
  13. Martin-Belmonte F, Martinez-Menarguez JA, Aranda JF, Ballesta J, de Marco MC, Alonso MA. MAL regulates clathrin-mediated endocytosis at the apical surface of Madin-Darby canine kidney cells. J Cell Biol 2003; 163:155–164.[Abstract/Free Full Text]
  14. Sasajima K, Taniguchi Y, Okazaki S, et al. Sequential morphological studies of the esophageal carcinoma of rats induced by N-methyl-N-amylnitrosamine. Eur J Cancer Clin Oncol 1982; 18:559–564.[CrossRef][Medline]
  15. Mimori K, Kataoka A, Yoshinaga K, et al. Identification of molecular markers for metastasis-related genes in primary breast cancer cells. Clin Exp Metastasis 2005; 22:59–67.[CrossRef][Medline]
  16. Mori M, Mimori K, Yoshikawa Y, et al. Analysis of the gene-expression profile regarding the progression of human gastric carcinoma. Surgery 2002; 131:S39–47.[CrossRef][Medline]
  17. Mimori K, Ishii H, Nagahara H, et al. FHIT is up-regulated by inflammatory stimuli and inhibits prostaglandin E2-mediated cancer progression. Cancer Res 2006; 66:2683–2690.[Abstract/Free Full Text]
  18. Buhler H, Schaller G. Transfection of keratin 18 gene in human breast cancer cells causes induction of adhesion proteins and dramatic regression of malignancy in vitro and in vivo. Mol Cancer Res 2005; 3:365–371.[Abstract/Free Full Text]
  19. Reichelt J, Furstenberger G, Magin TM. Loss of keratin 10 leads to mitogen-activated protein kinase (MAPK) activation, increased keratinocyte turnover, and decreased tumor formation in mice. J Invest Dermatol 2004; 123:973–981.[CrossRef][Medline]
  20. Santos M, Ballestin C., Garcia-Martin R, Jorcano JL. Delays in malignant tumor development in transgenic mice by forced epidermal keratin 10 expression in mouse skin carcinomas. Mol Carcinog 1997; 20:3–9.[CrossRef][Medline]
  21. Schutte B, Henfling M, Kolgen W, et al. Keratin 8/18 breakdown and reorganization during apoptosis. Exp Cell Res 2004; 297:11–26.[CrossRef][Medline]
  22. Caulin C, Salvesen GS, Oshima RG. Caspase cleavage of keratin 18 and reorganization of intermediate filaments during epithelial cell apoptosis. J Cell Biol 1997; 138:1379–94.[Abstract/Free Full Text]
  23. Tognon C, Garnett M, Kenward E, Kay R, Morrison K, Sorensen PH. The chimeric protein tyrosine kinase ETV6-NTRK3 requires both Ras-Erk1/2 and PI3-kinase-Akt signaling for fibroblast transformation. Cancer Res 2001; 61:8909–8916.[Abstract/Free Full Text]
  24. Cowling V, Downward J. Caspase-6 is the direct activator of caspase-8 in the cytochrome c-induced apoptosis pathway: absolute requirement for removal of caspase-6 prodomain. Cell Death Differ 2002; 9:1046–56.[CrossRef][Medline]
  25. Nyormoi O, Wang Z, Bar-Eli M. Sequence-based discovery of a synthetic peptide inhibitor of caspase 6. Apoptosis 2003; 8:371–376.[CrossRef][Medline]
  26. Banks-Schlegel SP, Harris CC. Tissue-specific expression of keratin proteins in human esophageal and epidermal epithelium and their cultured keratinocytes. Exp Cell Res 1983; 146:271–280.[CrossRef][Medline]
  27. Viaene AI, Baert JH. Expression of cytokeratin mRNAs in normal human esophageal epithelium. Anat Rec 1995; 241:88–98.[CrossRef][Medline]
  28. Preston SL, Wong WM, Chan AO, et al. Bottom-up histogenesis of colorectal adenomas: origin in the monocryptal adenoma and initial expansion by crypt fission. Cancer Res 2003; 63:3819–25.[Abstract/Free Full Text]
  29. Shih IM, Wang TL, Traverso G, et al. Top-down morphogenesis of colorectal tumors. Proc Natl Acad Sci USA 2001; 98:2640–2645.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mimori, K.
Right arrow Articles by Mori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mimori, K.
Right arrow Articles by Mori, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS