Annals of Surgical Oncology Sign the Guestbook
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/s10434-007-9376-x
Annals of Surgical Oncology 14:1909-1918 (2007)
© 2007 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, S. R.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, S. R.
Right arrow Articles by Jiang, W. G.

Original Article

Differential Expression and Prognostic Implications of the CCN Family Members WISP-1, WISP-2, and WISP-3 in Human Breast Cancer

Simon R. Davies, MRCS, Gareth Watkins, BSc, Robert E. Mansel, MS, FRCS and Wen G. Jiang, MD

Metastasis and Angiogenesis Research Group, Department of Surgery, University Hospital of Wales, Heath Park, Cardiff CF14 4XN, United Kingdom

Correspondence: Address correspondence and reprint requests to: Simon R. Davies, MRCS; E-mail: Simondavies{at}doctors.org.uk


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: The CCN family has three Wnt-inducted secreted proteins named WISP-1, WISP-2 and WISP-3. These molecules are known to play a diverse role in cells, but their role in cancer cells remains controversial.

Methods: In this study, we analyzed the expression of the three WISP molecules at the mRNA and protein levels in a cohort of 122 human breast tumors and 32 normal breast tissues, and we correlated these findings with patients’ clinical outcomes.

Results: WISP-1 transcripts were found in lower levels in node-positive tumors compared with node-negative tumors (P < .05); were lower in patients with a moderate (P = .01) and poor Nottingham Prognostic Index prognosis (P < .05) compared with good prognostic groups; were of significantly lower level in grade 3 differentiated tumors (P < .05) compared with grade 1; and were of lower levels in patients who developed metastasis and died from breast cancer–related causes (P < .05 in both comparisons). Almost the reverse was found to be true for WISP-2, which had greater levels of expression in node-positive tumors (P = .0043); higher levels in both moderate and poor prognostic groups compared with the good prognostic group (both P < .05); greater level in both grade 2 and 3 when compared with grade 1 (both P < .05); and higher levels in patients who went on to develop metastases (P < .01). WISP-3 transcript levels showed no statistically significant differences between groups.

Conclusions: WISPs may play important but contrasting roles in breast cancer. WISP-1 seems to act as a tumor suppressor and WISP-2 as a factor that stimulates aggressiveness; WISP-3 has no definable beneficial or detrimental role.

Key Words: WISP-1 • WISP-2 • WISP-3 • CCN • Breast cancer


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The CCN family (named by the first letters of the first three molecules discovered) compresses an ever-growing number of molecules. The first to be discovered were cysteine-rich 61 (Cyr61/CCN1), connective tissue growth factor (CTGF/CCN2), and nephroblastoma overexpressed (Nov/CCN3).1 The next to be identified were three Wnt-inducted secreted proteins, which were named WISP-1/CCN4, WISP-2/ CCN5, and WISP-3/CCN6. It is these proteins and their effects that we study here.

The CCN proteins have a molecular structure with up to four distinct functional domains. They are specifically associated with the extracellular matrix and are induced by growth factors such as transforming growth factor (TGF)-ß, cytokines like endothelin 1, and events that result in cellular stress, such as hypoxia. They have also been found to be overexpressed in pathological conditions that affect connective tissue, such as scarring, fibrosis, and cancer. The CCN family as a whole seems to stimulate mitosis, adhesion, apoptosis, extracellular matrix production, and migration and growth arrest.2 These abilities are probably due to the families’ ability to bind and activate cell-surface integrins and intracellular signaling molecules, including fibulin 1C, Notch 1, S100A4, and ion channels3 and also the way that they modulate the activity of different growth factors such as TGF-ß. Cyr61 (CCN1) and Nov (CCN2) have been indicated as being angiogenic,4 but little evidence indicates that WISPs have a similar impact on angiogenesis.

Despite these advances in understanding the biology of the molecules in cells and their signaling pathways, their role in cancer is unclear. WISPs have previously been implicated as being important in the tumorigenesis and metaplasia in a variety of tissues. However, these effects are not universal; the proteins exert transforming and growth stimulatory effects on some cell types while causing inhibition of growth and metastasis of tumor in others.

The WISP-1 gene, which is located at 8q24.1–8q24.3, has previously been found to be highly expressed in primary breast cancers, and it shows a strong association between stage, tumor size, lymph node status, and HER-2/neu expression versus mRNA level.5 The same has been seen in colon cancer cell lines compared with normal mucosa,6,7 but in H460 lung cancer, WISP-1 overexpression leads to an inhibition of lung metastasis and in vitro cell invasion and motility.8

The WISP-2 gene, located at 20q12–20q13, is thought to have a particular relevance in human breast disease9 because mRNA and protein levels are increased in different human breast tumor–derived cell lines, but the levels are barely detectable in normal breast epithelial cells. Silencing the WISP-2 gene functions also minimizes serum-induced breast tumor cell proliferation,9 although in contrast, it can be up-regulated in noninvasive MCF-7 human breast tumor cells by epithelial growth factor, which is believed to be linked to poor prognosis in breast cancer.10

The WISP-3 gene is located at 6q22–6q23. This locus displays high rates of loss of heterozygosity in breast cancer.11,12 WISP-3 seems to play an important role as a tumor suppressor gene in inflammatory breast cancer, with its restoration resulting in growth inhibition in vitro and in vivo.13 More recently, it has been proposed that WISP-3 plays an important role as a growth regulatory protein in mammary epithelium and controls the cellular responses to the growth stimulatory effects of insulinlike growth factor 1.14 The loss of WISP-3 expression alters the phenotype of the breast epithelium and promotes motility and invasion.

The role of the CCN family in the development of clinical caner is unclear—and in some cases controversial and unproven. In this current study, we examined the relationship between each of the three Wnt-inducted secreted proteins by looking at their levels in a cohort of human breast cancer and studying the clinical outcomes. To our knowledge, until now, these proteins have not been studied together and directly compared in human breast tumors.

We report that WISP-2 is overexpressed in tumor tissues and is linked to the progressive nature of breast tumors; WISP-1 exhibited lower levels and was inversely linked to poor prognosis; and WISP-3 showed no marked association with cancer development. This suggests that, as has been seen with previous members of the CCN family, differentially expressed CCN molecules have clearly contrasting roles in the development of human breast cancer.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Sample Collection
The European Collection of Animal Cell Cultures (ECACC, Salisbury, UK) provides the human breast cancer cell lines MCF-7, MDA MB 231, BT-549, and human fibroblast cell line MRC-5; TCS Biologicals (Oxford, UK) provided the human umbilical vein endothelial cells. Breast cancer tissue (n = 120) and normal background tissue (n = 32) were collected immediately after surgery and stored in a deep freeze until use. Patients were routinely followed up clinically after surgery for a median period of 120 months. The presence of tumor cells in the collection tissues was verified by a consultant pathologist (Anthony Douglas-Jones, University of Wales College of Medicine, Cardiff University) by hematoxylin and eosin–stained frozen sections.15,16 Details of the histology were obtained from pathology reports and are listed in Table 1Go.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Clinical and pathological information of the study cohort
 
Materials
RNA extraction kits and reverse transcription kits were obtained from AbGene, Guildford, Surrey, UK). Polymerase chain reaction (PCR) primers were designed by Beacon Designer (Palo Alto, CA) and synthesized by Invitrogen (Paisley, Scotland, UK). Molecular biology–grade agarose and DNA ladder were purchased from Invitrogen, and Mastermix for routine PCR and quantitative PCR came from AbGene. WISP-1, -2, and -3 antibodies were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA), as follows: for WISP-1 (sc-8865), a goat polyclonal antibody raised against a peptide mapping at the carboxy terminus of WISP-1 of human origin; for WISP-2 (sc-8868), goat polyclonal antibody mapping the C terminus of WISP-2 of human origin; and for WISP-3 (sc-25443), rabbit polyclonal antibody against amino acids 231–295 of WISP-3 of human origin. Anti-actin was also purchased from Santa Cruz Biotechnologies.

Tissue Procession, RNA Extraction, and cDNA Synthesis
Frozen sections of tissue were cut to thicknesses of 5 to 10 µm and kept for immunohistochemistry and routine histology.17 A further 15 to 20 sections were homogenized with a handheld device in ice-cold RNA extraction solution. The concentration of the RNA was determined with an ultraviolet spectrophotometer. A reverse transcription kit with an anchored oligo-dT primer (supplied by AbGene) was used to carry out reverse transcription with 1 µg total RNA in a 96-well plate. The quality of the cDNA was verified with ß-actin primers.

Quantitative Analysis of CCN Family Members
The transcripted level of WISP-1, -2, and -3 from the above-prepared cDNA was determined by real-time quantitative PCR, which is based on Amplifluor technology18 that we modified from a previously reported method.17,19 A pair of PCR primers was designed with Beacon Designer software (version 2). To one of the primers (a antisense primer routinely used in our laboratory), we added an additional sequence, known as the Z sequence (5'-ACTGAACCTGACCGTACA-3'), which is complementary to the universal Z probe18 (Intergen, Oxford, UK). A Taqman detection kit for ß-actin was purchased from Perkin-Elmer (PE - applied Biosystems, Foster City, CA). The primers used wereasfollows:WISP-1: CAAGAGGCCACGCAAG AC and ACTGAACCTGACCGTACAGTAGGCT ATGCAGTTCCTGT; WISP-2: AGTGGGGCTGG AAGGTCT and ACTGAACCTGACCGTACAC TCTT GGCAGAGGACGAC; WISP-3: ACAAAAC AAATGCCAGCTTAT and ACTGAACCTGACC GTACACATTGGTCACCC TGTTAGAT. Primers used for quantitation of estrogen receptor (ER) and ER-ß were as reported previously20: ER, 5'-CCTA CTACCTGGAGAACGAG-3' and 5'-CTCTTCG GTCTTTTCGTATG-3' and ER-ß, 5'-AAAAGA ATCATTCAATGACA-3' and 5'-ATTAACACCT CCATCCAACA-3'. Cytokeratin-19 (CK19) was used for comparison of cellularity during the analysis and primers for CK19 were 5'-CAGGTCCGAGGT-TACTGAC-3' and 5'-ACTGAACCTGACCG TACA CACTTTCTGCCAGTGTGTCTTC-3'.21,22

The reaction was performed with the following: Hotstart Q-Master Mix (AbGene), 10 pmol of specific forward primer, 10 pmol of reverse primer that has the Z sequence, 100 pmol of 6-carboxyfluoresce-in–tagged probe (Intergen), and cDNA from approximately 50 ng RNA (calculated from the starting RNA in the reverse transcriptase reaction). The reaction was carried out with the IcyclerIQ (BioRad, Hemel Hempstead, UK), which is equipped with an optic unit that allows real-time detection of the 96 reactions under the following conditions: 94°C for 5 minutes, and 50 cycles of: 94°C for 15 seconds, 55°C for 35 seconds, and 72°C for 20 seconds.19,22,23 The levels of the transcripts were generated by using an internal standard17 that was simultaneously amplified with the samples. They are shown here in two ways: levels of transcripts based on equal amounts of RNA, and a target/CK19 ratio.

Immunohistochemical Staining of the CCN Family Proteins
The frozen sections of breast tumor and background tissue were cut to a thickness of 6 µm with a cryostat.23 The samples were mounted onto Super Frost Plus microscope slides, air dried, and then fixed in a mixture of 50% acetone and 50% methanol and air dried once again. The sections were then placed into OptiMax wash buffer for 20 minutes in a .6% horse serum blocking solution and probed with the primary antibody. Extensive washing occurred before the sections were incubated with the secondary bio-tinylated antibody (Multilink Swine anti-goat/mouse/ rabbit immunoglobulin made up in wash buffer and horse serum to the manufacturers’ specification; Vector Laboratories, Burlingame, CA) for 30 minutes. After further washing, avidin-biotin complex (Vector Laboratories) was then applied before a final washing of the samples. Diaminobenzidine chromogen (Vector Laboratories) was added to the sections, which were then incubated in the dark for 5 minutes before being counterstained in Gill hematoxylin and dehydrated in ascending grades of methanol before cleaning with xylene and mounting under a cover slip. Cytoplasmic staining of the respective proteins was quantified by Optimas 6.0 software as described previously21,24 and is shown here as relative staining intensity.

Western Blot Test
Cells (MCF-7, MDA-MB-231, and BT549, from ECACC) were extracted with a lysis buffer containing 2.4 mg/mL of Tris, 4.4 mg/mL of NaCl, 5 mg/mL of sodium deoxycholate, 20 µg/mL of sodium azide, 1.5% Triton X-100, 100 µg/mL of phenylmethyl sulfonyl fluoride, 1 µg/mL of leupeptin, and 1 µg/mL of aprotinin for 30 minutes. Protein concentrations were measured with fluorescamine and quantified with a multifluoroscanner (Denly, Sussex, UK). The samples were then boiled at 100°C for 5 minutes before clarification at 13,000 x g for 10 minutes. Equal amounts of protein from each cell sample (controls and treated) were added onto an 10% polyacrylamide gel together with a protein molecular marker (SDS6H; Sigma, Dorset, UK). Protein blot was probed with respective antibodies (goat anti-human WISP-1 and anti–WISP-2, rabbit anti-human WISP-3 and goat anti-actin, used at 1:500 dilution) followed by washing and subsequent probing with appropriate peroxidase-conjugated secondary antibodies (anti-goat IgG–horseradish peroxidase and anti-rabbit IgG-horseradish peroxidase, from Sigma). Protein bands were visualized with Supersignal West Dura Extended Duration Substrate chemiluminescent system (Perbio Science UK, Cramlington, UK) and detected with a CCD UVI Prochemi system (UVItec, Cambridge, UK).

Statistical Analysis
The statistical analysis was carried out by the Mann-Whitney U-test (Minitab version 12.1).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of CCN Members in Breast Tissue
By quantitative PCR, we found that WISP-1 occurred at lower levels in tumor tissues compared with normal tissue, but this finding was not statistically significant (Fig. 1Go, left). WISP-2 also occurred at lower levels (Fig. 1Go, middle), but WISP-3 was present in greater volumes (Fig. 1Go, right), although not to a statistically significant level.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 1. Level of WISP expression in human breast tumors compared with normal breast tissue.

 
Distribution of CCN Members in Different Cell Types
The presence of all three WISP proteins in three breast cancer cell lines was tested by Western blot test. As shown in Fig. 2AGo, WISP-1 and -3 were seen at good levels in both MDA-MB-231 and BT-549 cells, whereas WISP-2, which was present at lower levels in MCA-MB-231 and BT-549, expressed at a higher level in MCF-7 cells. By immunohistochemical analysis (Fig. 2BGo), WISP-1 showed strong staining of the normal epithelial, stromal, and endothelial cells but only weakly stained the cancer cells. In contrast, WISP-2 strongly stained both cancer and endothelial cells in the invasive cancer cells, but the staining was visibly weaker in the normal tissue (Fig. 2CGo). The pattern of WISP-3 staining is similar to WISP-1, with weak staining of cancer cells; however, WISP-3 did not show such strong staining of endothelial cells (Fig. 2DGo).


Figure 2
View larger version (392K):
[in this window]
[in a new window]

  		FIG. 2. Detection of WISP proteins in breast cancer cell lines by Western blot test (A) and in breast tissues by immunohistochemical analysis (B–D).

 
Levels of CCN Members and Relationship with Prognostic Indices and Nodal Involvement
The prognostic indices used in this study are twofold: the nodal status and the Nottingham Prognostic Index (NPI; where NPI-1 represents patients with NPI <3.5 and good prognosis, NPI-2 is 3.5 to 5.4 and moderate prognosis, and NPI-3 is >5.4 and poor prognosis).

Figures 3Go and 4Go show the results graphically. There were significantly lower levels of expression of WISP-1 in the node-positive tumors compared with the node-negative ones (P < .05, Fig. 3Go, left). The reverse is true for WISP-2, in which there is significantly greater levels of expression in the node-positive tumors (P = .0043, Fig. 3Go, middle). WISP-3 did not show any significant differences between the tumor types (Fig. 3Go, right).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 3. Level of WISP expression when comparing samples from patients with or without nodal involvement.

 

Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 4. Level of WISP expression when comparing samples from patients with different Nottingham Prognostic Index (NPI) values, where NPI-1 represents patients with NPI <3.5 (good prognosis), NPI-2 is NPI 3.5–5.4 (moderate prognosis), and NPI-3 is NPI >5.4 (poor prognosis).

 
When comparing the WISP samples, we looked at the differences between levels of transcript in NPI-1 compared with NPI-2 and NPI-3, respectively. Significantly lower levels of WISP-1 were seen in both analyses (NPI-2 P = .01, NPI-3 P < .05, Fig. 4Go, left). In contrast, WISP-2 showed significantly higher levels in both (NPI-2 P < .05, NPI-3 P < .05, Fig. 4Go, middle). As with nodal status, no differences were found in WISP-3 transcript in the different groups (Fig. 4Go, right).

Levels of CCN members and relationship with tumor differentiation (grading) and the tumor, node, metastasis (TNM) system staging: WISP-1 transcript was found in significantly lower levels in grade 3 differentiated tumors (P < .05, Fig. 5Go, left) and a marginally significant reduction in grade 2 differentiated tumors compared with grade 1. WISP-2 was found in significantly greater levels in both grades 2 and 3 when compared with grade 1 (both P < .05, Fig. 5Go, middle). There was no difference with WISP-3 between the grades (Fig. 5Go, left).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 5. Level of WISP expression when comparing samples from patients with different grades of tumor differentiation.

 
When looking at TNM staging, the trends show lower levels for WISP-1 and WISP-3 and higher levels of WISP-2 in the higher TNM stages, but none of the results is statistically significant (Fig. 6Go).


Figure 6
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 6. Level of WISP expression when comparing samples from patients with different tumor, node, metastasis system scores.

 
CCN and Clinical Outcome
After a 10-year follow-up, patients were divided into four groups: those who remained disease-free, those whose disease metastasized, those with local recurrence of disease, and those who died from the breast cancer (unrelated deaths were excluded). As can be seen in Fig. 7Go (right), patients who developed metastasis and died from breast cancer had significantly lower levels of WISP-1 (P < .05 in both comparisons). When looking a local recurrence, the trend continued, with lower transcript levels found with WISP-1; however, the level was only marginally significant. WISP-2, in contrast, was found in significantly higher levels in patients who went on to develop metastases (P < .01, Fig. 7Go, middle), although there was no clear difference in those who developed local recurrence or died. As with the rest of the analyses, WISP-3 showed no statistically significant difference in any of the clinical outcomes (Fig. 7Go, right).


Figure 7
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 7. Level of WISP expression when comparing samples from patients with different clinical outcomes.

 
CCN and Angiogenesis
We performed a correlation test between the CCN members, Cyr61, Nov, CTGF,25 WISP-1, WISP-2, and WISP-3 as presented here, and between angiogenic markers previously reported from the same cohort by us, including PECAM1 (CD31),26 VE-cadherin (cadherin-5),26 tumor endothelial marker (TEM)-8,27,28 and vascular endothelial growth factor R1. Cyr61 significantly correlated with WISP-1 (r = 204, P < .05) and Nov; CTGF correlated with vascular endothelial growth factor R1 (r = 273, r = .362, P < 001 for both). Interestingly, WISP-3 showed a marginal correlation with PECAM1 (CD31) (r = .191, P = .05). No statistically significant correlation was found with the proposed tumor specific endothelial marker, TEM-8.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
This study shows an aberrant expression of the CCN family member WISP-1, -2, and -3 in human breast cancer. The results have important clinical implications for patients, depending on which of the WISP transcripts is present.

Our study follows from a similar study which looked at Cyr61, CTGF, and Nov, three other members of the CCN family.29 This previous study similarly showed marked variations in the outcome with the different member of the CCN family. It was concluded that high levels of Cyr61 were associated with a poorer prognosis, nodal involvement, and metastatic disease, while CTGF showed the opposite, with low levels being associated with poor prognosis, metastasis, local recurrence, and mortality. Nov was also found in lower levels in patients who had a poor prognosis and high rates of mortality.

The results from this study provide further insight into the different expression patterns of the CCN members. WISP-1, like CTGF and to a lesser extent Nov, were found in lower levels in tumors than WISP-2 or Cyr61. The clinical significance of the low-level expression is most clearly seen when comparing the levels in patients who developed metastasis and died from breast cancer (Fig. 6Go, right and middle). WISP-3 is the first of the CCN members studied so far that did not show any important variation in our cohort of breast tumor patients.

WISP-1 levels were far lower in the patients who developed metastasis and died from their disease. The transcript levels were also far lower in patients with node-positive disease, those with NPI-2 and NPI-3, and those with high-grade tumors. We can conclude that WISP-1 has potential tumor suppressive action in breast cancer. This result contrasts with the previously published results of Xie et al.5 They reported high levels of WISP-1 expression in 46% of their patients with primary breast cancer. They also stated that those with higher stage, tumor size, positive lymph node status, and HER-2/neu expression had far higher WISP-1 levels than their controls. The study by Xie et al.5 did not provide information at the protein level and was conducted on a relatively small cohort (n = 44). A similar discrepancy is seen when comparing our results to those found in experiments with colon cancer with an overexpression of WISP-1 RNA in colon cancer cell lines compared with normal mucosa.6,7 WISP-1 has been shown to have tumor suppressive actions in H460 lung cancers8 and also in the equivalent molecule in mice, mELM1, which is downregulated in highly metastatic mouse melanoma cells.30 It is possible, therefore, that the role of WISP-1 as a proaggressive factor or as a tumor suppressor depends on tumor histology.

Our results for WISP-2 contrast with those for WISP-1, which has an association between high transcript levels of WISP-2 and more aggressive tumors. There were raised levels in patients with NPI-2 (moderate prognosis) and NPI-3 (poor prognosis), positive nodal status, moderate and high grade, and metastasis compared with indicators of good prognosis. There is evidence that there is disparity in the way WISP-2 functions in various cell types. It was found that in leiomyomas, WISP-2 exerted an important function in maintaining the normal uterine phenotype, and that loss of its actions may account, at least in part, for tumorigenesis.31 This contrasts with other studies that correlate well with our results, which show there to be an overexpression of WISP-2 mRNA in breast tumor cells, although the expression is virtually undetected in normal mammary epithelial cell controls.9,32 It is because of these findings that WISP-2 is seen as an important focus for breast cancer research, and the results we have achieved further emphasize the significance of WISP-2.

The results for WISP-3 suggest that the protein behaves as neither a promoter nor a suppressor with human breast tumors. There were no statistically significant differences in any of the clinically important prognostic tests. WISP-3 has been shown to be lost in most inflammatory breast cancers, a highly aggressive and metastatic form of breast cancer,33 but when it is restored, the growth of inflammatory breast cancer cells is inhibited in vitro and in vivo. Therefore, WISP-3 acts as a tumor suppressor gene.13 Because of the relative rarity of inflammatory breast cancer in our cohort, we could not verify the results of Kleer et al.13 Our results do suggest that the tumor suppressive effects seen in inflammatory breast cancer are not duplicated in the other, less aggressive forms of cancer. Zhang et al.14 also showed that by inhibiting WISP-3 expression in human mammary epithelial cells, they could induce epithelial-mesen-chymal transition; promote anchorage independent growth, motility, and invasiveness; and sensitize the cells to the growth effects of insulinlike growth factor 1. As a side note, WISP-3 has been suggested as a novel target in the development of MSI-H colorectal carcinomas.34

The contrast between each of the different WISPs suggests very different roles for the proteins in the development of breast cancer. Why such a variation exists remains unclear.

The data exploring the possible angiogenesis effects of the CCN family show some correlation—for example, Cyr61 and WISP-1, PECAM1 (CD31), and WISP-3. It should be pointed out, however, that this type of correlation is somewhat arbitrary and should be read with caution. More research is needed to investigate this interesting relationship.

The CCN family members WISP-1, WISP-2, and WISP-3 display different patterns of aberration in their expression in human breast cancer. WISP-1 is clearly linked to tumor suppressive activities, with its level being inversely proportional to tumor aggression. In contrast, WISP-2 is associated with the aggressive nature of breast cancer, and it is found in high levels in patients with the poorest prognostic outlook. WISP-3 levels show no relationship with prognostic indicators in either a protective or detrimental way and are therefore of no clinical value when looking at breast tumors in general. The contrasting expression patterns of WISP-1 and WISP-2 may indicate a therapeutic and prognostic role that warrants further investigation into the molecular aspects. The data further suggest a possible relationship between the CCN family and angiogenesis. However, further research is needed to investigate this interesting relationship.


   ACKNOWLEDGMENTS
 
Supported by Cancer Research Wales.

Received for publication November 15, 2006. Accepted for publication January 20, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Planque N, Perbal B. A structural approach to the role of CCN (CYR61/CTGF/NOV) proteins in tumourigenesis. Cancer Cell Int 2003; 3:15–30.[CrossRef][Medline]
  2. Bringstock D. The CCN family: a new stimulus package. J Endocrinol 2003; 178:169–75.[Abstract]
  3. Perbal B, Brigstock D, Lau L. Report on the second international workshop on the CCN family of genes. Mol Pathol 2003; 56:80–5.[Abstract/Free Full Text]
  4. Leask A, Abraham DJ. All in the CCN family: essential matricellular signalling modulators emerge from the bunker. J Cell Sci 2006; 119:4803–10.[Abstract/Free Full Text]
  5. Xie D, Nakachi K, Wang H, Elashoff R, Koeffler P. Elevated levels of connective tissue growth factor, WISP-1 and CYR61 in primary breast cancers associated with more advanced features. Cancer Res 2001; 61:8917–23.[Abstract/Free Full Text]
  6. Pennica D, Swanson T, Welsh J, et al. WISP genes are members of the connective tissue growth factor family that are up-regulated in Wnt-1 transformed cells and aberrantly expressed in human colon tumours. Proc Natl Acad Sci U S A 1998; 95:14717–22.[Abstract/Free Full Text]
  7. Khor T, Gul Y, Ithnin H, Seow H. A comparative study of the expression of Wnt-1, WISP-1, surviving and cyclin-D1 in colorectal cancer. Int J Colorectal Dis 2006; 21:291–300.[CrossRef][Medline]
  8. Soon L, Yie T, Shvarts Levine A, Su F, Tchou-Wong K. Overexpression of WISP-1 down regulated motility and invasion of lung cancer cells through inhibition of rac activation. J Biol Chem 2003; 278:11465–70.[Abstract/Free Full Text]
  9. Banerjee S, Sengupta K, Saxena N, Dhar K, Banerjee S. Epidermal growth factor induces WISP-2/CCN5 expression in estrogen receptor-{alpha}–positive breast tumour calls through multipul modular cross-talks. Mol Cancer Res 2005; 3:151–62.[Abstract/Free Full Text]
  10. Banerjee S, Saxena N, Sengupta K, Tawfik O, Mayo M, Banerjee S. WISP-2 gene in human breast cancer: estrogen and progesterone inducible expression and regulation of tumor cell proliferation. Neoplasia 2003; 5:63–73.[Medline]
  11. Nessling M, Richter K, Schwaenen C, et al. Candidate genes in breast cancer revealed by microarray-based comparative genomic hybridization of archived tissue. Cancer Res 2005; 65:439–47.[Abstract/Free Full Text]
  12. Chappell S, Walsh T, Walker RA, Shaw J. Loss of heterozygosity at the mannose 6-phosphate insulin-like growth factor 2 receptor gene correlates with poor differentiation in early breast carcinomas. Br J Cancer 1997; 76:1558–61.[Medline]
  13. Kleer C, Zhang Q, Lan Q, Merajver S. WISP3 (CCN6) is a gercreted tumor-suppressor protein that modulates IGF signaling in inflammatory breast cancer. Neoplasia 2004; 6:179–85.[CrossRef][Medline]
  14. Zhang Y, Pan Q, Zhong H, Merajver S, Kleer C. Inhibition of CCN6 (WISP3) expression promotes neoplastic progression and enhances the effects of insulin-like growth factor-1 on breast epithelial cells. Breast Cancer Res 2005; 7:1080–9.[CrossRef]
  15. Hanavadi S, Martin T, Mansel R, Jiang W. Interleukin-11 and its receptor expression in human breast cancer. Ann Surg Oncol 2006; 13:802–8.[Abstract/Free Full Text]
  16. Martin T, Goyal A, Mansel R, Watkins G, Jiang W. The transcription factor for the E-cadherin complex, Twist, Slug and Snail, in human breast cancer. Ann Surg Oncol 2005; 12:1–9.[Free Full Text]
  17. Jiang W, Watkins G, Lane J, et al. Prognostic value of Rho family and rho-GDIs in breast cancer. Clin Can Res 2003; 9:6432–40.[Abstract/Free Full Text]
  18. Nazarenko A, Bhatnagar S, Hohman R. A closed tube format for amplification and detection of DNA based on energy transfer. Nucleic Acids Res 1997; 25:2516–21.[Abstract/Free Full Text]
  19. Jiang W, Douglas-Jones A, Mansel R. Level of expression of PPAR-gamma and its co-activator (PPAR-GCA) in human breast cancer. Int J Cancer 2003; 106:752–7.[CrossRef][Medline]
  20. Ye L, Martin T, Parr C, Harrison G, Mansel R, Jiang W. Biphasic effects of 17-ß-oestradiol on expression of occluding and transendothelial resistance (TER) and paracellular permiabiliy in human vascular endothelial cells. J Cell Physiol 2003; 196:362–9.[CrossRef][Medline]
  21. King J, Ofori-Acquash A, Stevens T, Al-Mehdi A, Fodstad O, Jiang W. Activated leukocyte adhesion molecule in breast cancer: prognostic indicator. Breast Cancer Res 2004; 6:478–87.[CrossRef]
  22. Parr C, Watkins G, Jiang W. The possible correlation of Notch-1 and Notch-2 with clinical outcome and tumour clinicopathological parameters in human breast cancer. Int J Mol Med 2004; 14:779–86.[Medline]
  23. Jiang W, Grimshaw D, Lane J, et al. A hammerhead ribozyme suppresses expression of hepatocyte growth factor/scatter factor receptor c-MET and reduces migration and invasiveness of breast cancer cells. Clin Cancer Res 2001; 7:2555–62; Erratum in: Clin Cancer Res 2002; 8:300.[Abstract/Free Full Text]
  24. Davies G, Jiang W, Mason M. Cell-cell adhesion and signalling intermediates in human prostate cancer. J Urol 2000; 163:985–92.[CrossRef][Medline]
  25. Jiang WG, Watkins G, Fodstad O, et al. Differential expression of the CCN family members Cyr61 from CTGF and Nov in human breast cancer. Endocr Relat Cancer 2004; 11:781–91.[Abstract/Free Full Text]
  26. Martin TA, Watkins G, Lane J, Jiang WG. Assessing mircovessels and angiogenesis in human cancer, using VE-cadherin. Histopathology 2005; 46:422–30.[CrossRef][Medline]
  27. Davies G, Rmaili K, Jiang WG. Tumour endothelial marker-8 (TEM-8) in human breast cancer: the correlation with angiogenesis. Int J Oncol 2006; 29:1311–7.[Medline]
  28. Davies G, Mason MD, Mansel RE, Jiang WG. Expression of tumour-endothelial markers in human breast cancer. Clin Exp Metastasis 2004; 21:31–7.[CrossRef][Medline]
  29. Jiang W, Watkins G, Fodsrad O, Douglas-Jones A, Mokbel K, Mansel R. Differential expression of the CCN family members Cyr61, CTGF and Nov in human breast cancer. Endocr Relat Cancer 2004; 11:781–91.[Abstract/Free Full Text]
  30. Babic A, Kireeva M, Kolesnikova T, Lau L. CYR61, a product of a growth factor–inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci U S A 1998; 2695:6355–60.
  31. Mason H, Lake A, Wubben J, Nowak R, Castellot J Jr. The growth arrest–specific gene CCN5 is deficient in human leiomyomas and inhibits the proliferation and motility of cultured human uterine smooth muscle cells. Mol Hum Reprod 2004; 10:181–7.[Abstract/Free Full Text]
  32. Zoubine M, Banerjee S, Saxena N, Campbell D, Banerjee S. WISP-2: a serum-induible gene differentially expressed in human normal breast epithelial cells and in MCF-7 breast tumor cells. Biochem Biophys Res Commun 2001; 282:421–5.[CrossRef][Medline]
  33. Van Golen K, Davies S, Wu Z, et al. A novel putative low-affinity insulin-like growth factor-binding protein, LIBC (lost in inflammatory breast cancer), and RhoC GTPase correlate with the inflammatory breast cancer phenotype. Clin Cancer Res 1999; 5:2511–9.[Abstract/Free Full Text]
  34. Thorstensen L, Diep C, Meling G, et al. WNT1 inducible signaling pathway protein 3, WISP-3, a novel target gene in colorectal carcinomas with microsatellite instability. Gastroenterology 2001; 121:1275–80.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
S. Banerjee, G. Dhar, I. Haque, S. Kambhampati, S. Mehta, K. Sengupta, O. Tawfik, T. A. Phillips, and S. K. Banerjee
CCN5/WISP-2 Expression in Breast Adenocarcinoma Is Associated with Less Frequent Progression of the Disease and Suppresses the Invasive Phenotypes of Tumor Cells
Cancer Res., September 15, 2008; 68(18): 7606 - 7612.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Pathol.Home page
T C Mullis, X Tang, and K T Chong
Expression of connective tissue growth factor (CTGF/CCN2) in head and neck squamous cell carcinoma
J. Clin. Pathol., May 1, 2008; 61(5): 606 - 610.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, S. R.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, S. R.
Right arrow Articles by Jiang, W. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS