Annals of Surgical Oncology Cite Track
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
10.1245/s10434-007-9397-5
Annals of Surgical Oncology 14:2159-2166 (2007)
© 2007 Society of Surgical Oncology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.

Original Article

The Role of Growth Differentiation Factor-9 (GDF-9) and Its Analog, GDF-9b/BMP-15, in Human Breast Cancer

S. Hanavadi, MS, FRCS, T. A. Martin, PhD, G. Watkins, HND, R. E. Mansel, MS, FRCS and W. G. Jiang, MB BCh, MD

Metastasis and Angiogenesis Research Group, Wales College of Medicine, Cardiff University, Cardiff, UK

Correspondence: Address correspondence and reprint requests to: W. G. Jiang, MB BCh, MD; E-mail: jiangw{at}cf.ac.uk


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Background: There has been a recent surge of interest in the role of growth differentiation factors and other bone morphogenic proteins in the development and spread of cancer. In this study we have provided evidence that highlights the significance of growth and differentiation factor-9a (GDF-9a) and GDF-9b (bone morphogenic protein-15, BMP-15) in breast cancer development and progression.

Methods: Primary breast cancer samples (n = 109) and matched background tissues from same patients (n = 33) were processed for frozen section and RNA extraction. Frozen sections from matched tissues were immunostained with GDF-9a and GDF-9b antibodies. Staining intensity was analyzed by computer image analysis. RNA was reverse transcribed and quantified before analysis by quantitative polymerase chain reaction (Q-PCR). Results were expressed as number of transcripts (standardized by ß-actin). The data were compared with the clinical outcome of the disease. The biological effects of the molecule were studied using in vitro assays after forced expression in breast cancer cells.

Results: Highly aggressive breast cancer cells did not express GDF-9a. On forced expression of GDF-9a, breast cancer cells became less invasive. These laboratory findings were analyzed against the clinical information. Primary breast cancer samples with good predicted prognosis had a significantly higher level of GDF-9a than in samples with poor predicted prognosis (P = .004). Patients who remained disease-free at the end of a 10-year follow-up had significantly higher levels of both GDF-9a and GDF-9b in their tissue than those with poor clinical outcome (P = .001 and .014, respectively).

Conclusion: Growth differentiation factor-9 family expressed in breast cancer has an inhibitory effect on the progression of human breast cancer.

Key Words: Growth differentiation factor-9 • Bone morphogenic protein-15 • Breast cancer • Prognosis • Survival


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Breast cancer in women is an important cause of morbidity and mortality in the western population and is the leading cause of death among women globally.1 Breast cancer development and progression is a multistep process with complex interaction between cancer cells and the host environment. Breast cancer commonly metastasizes to bone. The factors that disrupt the precise balance between growth inhibitors and promoters with subsequent development and metastasis of cancer are poorly understood. Many of these factors have remained elusive and research in this area can be a potential supplement for developing treatment strategies.

Bone morphogenic proteins (BMPs) described initially by Urist et al.2 constitute a large family of cytokines, related to members of the transforming growth factor-ß superfamily. They are multifunctional regulators of proliferation, differentiation, and apoptosis and are involved in the development of various organs.3,4 Being regulators of proliferation and differentiation, these proteins have attracted the attention of many investigators for their possible link with tumourigenesis. In addition, BMPs were found to constitute an important signaling pathway in bone.5 This observation has created an interest in studying their possible link with establishment of metastatic lesion in the bone.

Studies have demonstrated the presence of the TGF-ß signaling pathway in mammary cells and its importance in maintaining the growth state of these cells6,7 Recent studies have shown the expression of some of these proteins, such as BMP 2, 6, and 7 in breast cancer cells and their possible role in breast cancer development and involvement in bone metastasis.7–9

Interleukin-11 is a known molecular complex that is linked to bone metastasis in human breast cancer.10,11 High levels of IL-11 are associated with the aggressive nature of clinical breast tumors.12 Furthermore, we have shown that IL-11 was able to down-regulate the expression of bone morphogenic protein (BMP)-15 in human breast cancer cells,13 indicating a possible link among IL-11, BMP-15, and bone metastasis in breast cancer. BMP-15, also known as growth and differentiation factor (GDF)-9b,3 belongs to the TGF-ß family and was found to be spatially and temporally similar to GDF-9a. Both GDF-9a and GDF-9b are potent regulators of follicular development and maturation in the ovary.14,15

These observations have encouraged us to explore further the possible link between GDF-9 and breast cancer development and progression. In the current study, we have examined the expression of both GDF-9a and BMP-15 (GDF-9b) in a cohort of human breast cancer samples and report here that the expression of both members of the TGF-ß family was reduced. We have shown that a reduction of GDF-9a and GDF-9b/BMP-15 in breast tumors was associated with an increased risk of metastasis and mortality in patients with breast cancer. We have also provided the evidence that forced expression of GDF-9a in breast cancer cells rendered these cells less invasive.


   METHODS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Patients and Tumor Samples
Breast cancer tissue and background tissue (non-neoplastic breast tissue) samples were obtained from fresh frozen bank in the Department of Surgery, University Hospital of Wales, Cardiff. The samples were collected randomly between 1992 and 1995. The follow-up duration of these cases ranged from 36–146 months (median 120 months). Those who could not be followed up and those who died of other causes were excluded from the study. The clinical data including the prognostic factors of each sample were collected and the Nottingham Prognostic Index16 was calculated. The histological grading system was based on modified Bloom and Richardson’s grading system.17 A total of 142 samples of background tissue (n = 33) and cancer tissue (n = 109) were studied. During the last follow-up, nine patients developed metastatic disease on follow-up and local recurrence was noted in six patients. There were 15 deaths recorded from breast-cancer–related causes at the end of follow-up (Table 1Go).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Transcript levels of GDF-9 and BMP-15 (GDF-9b) in breast cancer tissue samples
 
Breast Cancer Cell Lines and Culture Methods
The breast cancer cells were purchased from the European Collection for Animal Cell Culture (ECACC, Porton Down, Salisbury, UK). The cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Poole, Dorset, England) supplemented with 10% heat-inactivated fetal calf serum, benzyl penicillin, and streptomycin. The cells were incubated in small flasks at 37° C with a humidified atmosphere of 5% CO2. The cells were routinely trypsinized and employed for laboratory research.

Preparation of RNA, cDNA, RT-PCR, and Quantitative PCR
The frozen sections of breast specimens were homogenized at room temperature with 1 mL of RNA reagent using a homogenizer (Ultra-Turrax T8, IKA Labortechnik, North Cave, Humberside, UK). Total RNA was extracted from each sample using guanidinium thiocyanate method (RNA-Zol procedure).18 Complementary DNA (cDNA) was synthesized. The cDNA was quantified by quantitative polymerase chain reaction (Q-PCR) using Amplofluor Uniprimer system (Intergen Company, Oxford, UK) and Hot-Start master mix for quantitative PCR (ABgene, Epsom, Surrey, UK).19 Specific primer pairs for GDF-9a and GDF-9b/BMP-15 were designed using Beacon designer software (Biosoft International, Palo Alto, CA, USA) and manufactured by Invitrogen (Invitrogen Life Technologies, Paisley, Scotland, UK), each amplifying a region that spans at least one intron generating approximately 100 base pair products from both the control plasmid and cDNA. The primer sequence used was:

  1. For GDF-9a: 5' gcagaggtcaggaaactgt' 3 (forward primer) and 5' actgaacctgaccgtacaatggagctcaca' 3 (reverse primer)
  2. For GDF-9b/BMP-15: ' 5gtgaagcccttgaccagt' 3 and ' 5actgaacctgaccgtacattggtatagtcctcggtttg' 3
  3. ß-actin was used as the housekeeping control 5' atgatatcgccgcgctcg' 3 and 5' cgctcgtgtaggatctt-ca' 3.

By using Icycler IQ system (Bio-Rad, Hemel Hamstead, UK), the plasmid standards and the breast cancer cDNA were simultaneously assayed in duplicated reaction using a standard hot-start Q-PCR master mix. Q-PCR conditions were: enzyme activation at 95° C for 12 minutes, 1 cycle, followed by 60 cycles of denaturation: 95° C for 15 seconds; annealing: 55° C for 40 seconds; extension: 72° C for 25 seconds. Amplicons were detected at the annealing stage. Using purified plasmids as internal standards, the level of the respective molecule cDNA (copies/50 ng RNA) in the breast cancer samples was calculated. Q-PCR for ß-actin was also performed on the same samples to correct for any residual differences in the initial level of RNA in the specimens (in addition to spectophotometry). The products of Q-PCR were verified on agarose gels.

Immunohistochemistry
The methodology for immunostaining has been described in detail.12 A portion of the mammary tissues was processed for immunohistochemical analysis. Cryostat sections of frozen tissues were cut at 6 µ m, placed on superfrost plus slides, air dried, and fixed in a 50:50 solution of alcohol and acetone. The sections were air dried again and stored at –20° C. Just before commencing immunostaining, the sections were washed in buffer for 5 minutes and treated with serum buffer solution for 20 minutes as a blocking agent to nonspecific binding. Sections were stained using GDF-9a and anti- GDF-9b/BMP-15 antibodies (Santa-Cruz Biotechnology, Santa Cruz, CA, USA). Primary antibodies were used at 1:100 dilution for 60 minutes and then washed in buffer. The secondary biotinylated antibody at 1:100 dilution (Universal Secondary, Vectastain Elite ABC, Vector Laboratories Inc., Burlingame, CA, USA) was added (in horse serum/buffer solution) for 30 minutes followed with buffer washing. The sections were then treated with Avidin/Biotin complex for 30 minutes, followed with buffer washing. Diaminobezidine was used as a chromogen to visualize the antibody/antigen complex. Sections were counterstained in Mayer’s hematoxylin for 1 min, dehydrated, cleared, and mounted in DPX medium (Raymond A. Lamb, London, UK), and screened using an 25x objective. For negative control, the primary antibodies were omitted. In addition, breast cancer cell, MDA-MB-231, which was screened negative for GDF9, was used as a negative staining control. The intensity of staining, which is directly related to the quantity of GDF-9a and GDF-9b/BMP-15 in the section, was analyzed with the density analysis package of Optimas 6.0 software (Nothell, WA, USA).20

Cloning of GDF-9a and Construction of GDF-9a Expression Cassette
Full-length human GDF-9a was first amplified from a normal mammary cell using a pair of expression primers (5' atggcacgtcccaaca' 3 and 5' ttaacgacaggtgcactttgta' 3). The sequence verified PCR product was T-A cloned into the vector (pEF6/V5/His) according to the manufacturer’s instructions. The cloned product was transferred onto One ShotTM E.coli and grown in LB (Luria Bertani) agar plate. The colonies with plasmid that has insert GDF-9a in correct orientation was identified by orientation specific PCR. The identified plasmid vector colony was then transferred into 2 mL of LB medium, containing ampicillin and incubated until culture grew to mid-log phase at 37° C in a orbital shaker. The resultant culture was then added into 100 mL of LB medium (with ampicillin) and incubated overnight at 37° C shaking at 150 rpm. The plasmid DNA was extracted from within the E.coli using plasmid purification kit (Filter Maxi System, Qiagen, West Sussex, UK). After quantitation, the plasmid DNA was run on 0.8% agarose gel to check the purity and the size of the plasmid.

Transfection of cultured breast cancer cells (MDA MB 231) with GDF-9a expressed plasmid or control plasmid was done by electroporation technique using Easy Jet Plus system (Flowgen, Staffordshire, UK). The electroporated cells were then cultured in small flasks and positive cells were selected using blasticidin. The presence of GDF-9a in the transfected cell was verified using RT-PCR. The procedure resulted in the following cells: MDA-MB-231WT, MDA-MB-231P-control, and MDA-MB-231ExpGDF-9a.

Cell Growth Assay
The cells were seeded into a 96-well plate (Nunc, Denmark) at a density of 7000/well and incubated at 37° C for a 5-day period. MTT [3-(4,5-dim-ethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] was added in solution to the cells (200 µ g/well) and incubated for 4 hours at 37° C. The cells were then lysed with Triton (10%), and the intensity of the color released was determined by a plate reader (Titertek Multiskan, Eflab, Finland). The number of cells was shown as absorbance units.

Cell Matrix Adhesion Assay
Initially, 96-well plates were coated with 5 µ g of matrigel and allowed to dry. Following rehydration, cancer cells (10,000 per well) were added and incubated for 40 minutes. The wells were then gently washed eight times and stained with 100 µ L of diluted (1:10 with culture medium) sterile MTT. After removing excess stain, the cells were treated with 100 µ L of 10% Triton X100, and the intensity of the color was read by the plate reader giving the load of cells in each well.

Statistical Analysis
The Q-PCR products and the intensity of immunostaining of each sample were analyzed against different prognostic parameters. The mean value for each parameter was then calculated, and statistical analysis was performed using Mann-Whitney test (Minitab version 14, State College, PA, USA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Expression of GDF-9a in Breast Cancer Cells
Using RT-PCR, a panel of breast cancer cells was examined for expression of GDF-9a (Fig. 1Go). The expression of GDF-9a transcript was stronger in the following breast cancer cells: ZR 751, MDA-MB-157, MDA-MB-436, BT 474, and MCF 7, whereas expression was barely noticeable in MDA-MB-231 and MDA-MB-453.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 1. RT-PCR showing expression of GDF-9a in breast cancer cells. Top: GDF-9a transcript; bottom: housekeeping gene ß-actin transcript.

 
Effect of Forced Expression of GDF-9a on Growth of Breast Cancer Cells
We first established MDA-MB231 cells that over-expressed GDF-9a by transfection with the GDF-9a expression vector, followed by selection and growth of a stably transfected strain (MDA-MB-231ExpGDF-9a). The growth rate (measured using in vitro growth assay) was compared against wild-type MDA-MB-231 cells (Fig. 2Go). There was a significant decrease in the growth rate of breast cancer cell MDA-MB-231ExpGDF-9a in contrast to wild-type breast cancer cell (P = .02).


Figure 2
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 2. Growth curve demonstrating the effect of forced expression of GDF-9a in breast cancer cells. W.T., wild type.

 
Effect of GDF-9a on Matrix Adhesion of Breast Cancer Cells
Matrix adhesion of cancer cells is essential for cancer spread. The ability and ease with which cancer cells adhere to the matrix can be assessed using in vitro test. In this study we compared the matrix adhesion of breast cancer cell, MDA-MB-231 transfected with GDF-9a, with wild-type cell. The cell-matrix adhesion was measured as absorbance units. On forced expression of GDF-9a molecule, there was a significant decrease in matrix adhesion of MDA-MB-231 breast cancer cells (Fig. 3Go).


Figure 3
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 3. Effect of forced expression of GDF-9a on matrix adhesion of breast cancer cell MDA-MB-231. W.T., wild type.

 
Correlation Between GDF-9a and GDF-9b (BMP-15) Levels and the Nodal Status in Human Breast Cancer
Using Q-PCR, the transcript levels of both GDF-9a and BMP-15 were measured in primary breast cancer tissue samples (Table 1Go). On analysis, a significant difference was not demonstrated in either GDF-9a or GDF-9b levels between node negative and node negative tumor samples (P = .24 and .34, respectively).

Transcript Levels of GDF-9a and GDF-9b/BMP-15 Compared Against the Predicted Prognosis
Samples with good predicted prognosis had significantly higher levels of GDF-9a transcripts (level 782 ± 244) compared with poor predicted prognostic samples, based on the NPI prognostic index (level 50 ± 17), P = .004 (Fig. 4Go). It is interesting to note that the same link between GDF-9b/BMP-15 and predicted prognosis (based on NPI) was not demonstrated (P = .15).


Figure 4
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 4. GDF-9a level compared with the predicted prognosis in human breast cancer.

 
Expression of GDF-9a and BMP-15 and Their Relation to the Histological Grade of Tumor
The transcript level of GDF-9a was significantly high in samples with well-differentiated cells when compared with those having poorly differentiated cells (P = .006) (Fig. 5Go). On the other hand, no significant difference was noted in the transcript levels of GDF-9b/BMP-15 in different histological grade samples.


Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 5. GDF-9a level compared with the histological grade of breast cancer.

 
Impact of GDF-9a and GDF-9b/BMP-15 on Clinical Outcome in Human Breast Cancer
With median 10-year follow-up, the clinical outcome in patients with breast cancer was recorded as disease-free status or poor clinical outcome. The patients included within the poor outcome group were those who developed local recurrence or distant spread and those who died of breast-cancer–related causes. On analysis, a significantly higher mean transcript value of GDF-9a was noted in samples with 10-year disease-free survival (level 799 ± 362) as against the samples with poor clinical outcome (level 134 ± 59), P = .001. Similarly, the level of GDF-9b/BMP-15 was significantly higher in samples of disease-free status (level 4365 ± 2356) than those with poor clinical outcome (level 800 ± 260), P = .014. Figure 6Go demonstrates the clinical outcome from human breast cancer and the comparative levels of GDF-9a and GDF-9b/BMP-15 in the tissue samples.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 6. Levels of GDF-9a and BMP-15 compared with the clinical outcome from human breast cancer.

 
Immunostaining of Normal Mammary and Breast Cancer Tissue for GDF-9a and GDF-9b/BMP-15
The immunostaining sections for GDF-9a and GDF-9b/BMP-15 is shown in Fig. 7Go. The figure clearly demonstrates the darker staining of normal mammary epithelial tissue for both GDF-9a and GDF-9b/BMP-15 compared with breast cancer tissue, indicating higher protein levels of GDF-9a and GDF-9b/BMP-15 in normal compared with cancerous breast tissue.


Figure 7
View larger version (131K):
[in this window]
[in a new window]

  		FIG. 7. Immunohistochemical staining for GDF-9a and BMP-15 demonstrating the intensity of staining in normal mammary and breast cancer tissue.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
CONCLUSIONS
 REFERENCES
 
Cancer progression is a multistep process with complex interaction among various molecules within the cell. This interaction might result in either up- or down-regulation of various growth factors, leading to an unregulated proliferation of these cells. A number of these regulatory molecules have been identified and studied extensively. A large number of regulatory molecules are still elusive, and the appetite to identify new molecules is therefore everlasting.

When we examined a panel of breast cancer cells for expression of a number of growth factors of the TGF family, some of the breast cancer cells expressed GDF-9. Growth differentiation factor-9 is a growth factor belonging to the TGF-ß superfamily, identified initially by Incerti et al. in 1994.14 Until now GDF-9 expression was thought to be specific to the ovary.21,22 We have demonstrated for the first time that GDF-9 is also expressed in breast cancer cells. Being a potent regulator of mitosis, GDF-9 produced by the oocyte plays an important role in regulating cell proliferation and differentiation during follicle development.23 This stimulated us to think whether GDF-9 plays similar role in other cells when they are expressed—in this study, in breast cancer cells. The thought was further strengthened when we found that GDF-9 expression was restricted to less aggressive breast cancer cells only. Highly aggressive breast cancer cells did not express GDF-9, raising a hypothetical question, do breast cancer cells lose GDF-9 before they become aggressive? To get answer to these questions and to understand its biological role in these cells, we first expressed GDF-9a molecule forcibly in a MDA-MB-231 breast cancer cell by cloning. We studied the effect of GDF-9a on growth rate of these breast cancer cells by an in vitro growth assay. Wild-type MDA-MB-231 cells do not express GDF-9a, are highly aggressive, and grow rapidly. On forceful expression of GDF-9a, these cells showed a significant decrease in the growth rate. Similarly, on forced expression GDF-9a was also found to decrease the matrix adhesion of breast cancer cells. We know cell-matrix adhesion is an essential initial step in cancer metastasis. These findings suggest that GDF-9a act as a growth inhibitor in breast cancer and by decreasing cell-matrix adhesion, it inhibits cell invasion and therefore cancer spread.

Based on our findings, we hypothesize that GDF-9 has a regulatory effect on breast cancer growth and losing GDF-9 during cancer progression may confer cancer cells the ability to act aggressively. This encouraged us to study the expression profile of this molecule in primary breast cancer tissue samples. GDF-9a and its homolog, GDF-9b/BMP-15, are co-expressed in oocytes and have similar role in follicular development. Therefore, we studied the transcript levels of both GDF-9a and GDF-9b/BMP-15 in the clinical samples to analyze their clinical significance.

On analysis, although no significant difference in GDF-9 level was noted between node positive and node negative samples, a major correlation between GDF-9 expression and the clinical outcome was noted. A significantly high level of GDF-9a was noted in samples where a good prognosis was predicted. Patients who remained disease free at the end of follow-up had a high level of GDF-9a in their tissue. Samples with a low level of GDF-9a were found to be of poor histological grade tumors with an increased chance of developing local recurrence or distant metastasis. On the other hand, although the level of GDF-9b/BMP-15 transcript was high in normal mammary tissue compared with breast cancer tissue, no significant correlation was noted between GDF-9b/BMP-15 level and the histological grade or the predicted prognosis. However, a higher transcript level of GDF-9b/BMP-15 was noted in samples with disease-free survival status compared with those with poor clinical outcome.

Our studies have highlighted the importance of these factors, in particular GDF-9a in the progression of human breast cancer. There was a negative correlation between the expression of GDF-9 and the aggressive behavior of primary breast cancer. Growth differentiation factor-9 probably acts as a growth regulator, and therefore absence of this molecule could trigger the unregulated proliferation and differentiation of cells. Apart from being a predictor of good prognosis in human breast cancer, further study of its interaction with the receptor could open new venues for therapeutic intervention. Both GDF-9a and GDF-9b/BMP-15 may have a broader function than previously thought. Finally, the present study failed to demonstrate a prognostic value for both GDF-9a and GDF-9b/BMP-15, independent of histological grades. Further research should address its significance in the development of other cancers.


   CONCLUSIONS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
REFERENCES
 
The expression of both GDF-9a and GDF-9b/BMP-15 in human breast cancer tissues is aberrant at both mRNA and protein levels. The reduction of GDF-9a and GDF-9b/BMP-15 in breast tumors is correlated with the metastasis and increased mortality of the patients. Forced expression of GDF-9a in breast cancer cells rendered the cells less aggressive (slower growth rate and less adhesive to matrix). It is concluded that the growth differentiation factor-9 family expressed in breast cancer has an inhibitory effect on the progression of human breast cancer.


   ACKNOWLEDGMENTS
 
The authors wish to thank Cancer Research Wales (CRW) and Cancer Research UK (CR-UK) for supporting.

Received for publication July 13, 2006. Accepted for publication February 23, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 CONCLUSIONS
 REFERENCES
 

  1. Pisani P, Parkin DM, Ferlay J. Estimates of worldwide mortality from eighteen major cancers in 1985. Implications for prevention and projections of future burden. Int J Cancer 1993; 55:891–903.[Medline]
  2. Urist MR. Bone formation by autoregulation. Science 1965; 150:893–9.[Abstract/Free Full Text]
  3. Dube JL, Wang P, Elvin J, Lyons KM, Celeste AJ, Matzuk MM. The bone morphogenetic protein 15 gene is X-linked and expressed in oocytes. Mol Endocrinol 1998; 12:1809–17.[Abstract/Free Full Text]
  4. Phippard DJ, Weber-Hall SJ, Sharpe PT, Naylor MS, Jayatalake H, Maas R, Woo I, Roberts-Clarke D, Francis-West PH, Liu YH, Maxson R, Hill RE, Dale TC. Regulation of MSX-1, MSX-2, BMP-2 and BMP-4 during foetal and post-natal mammary gland development. Development 1996; 22:2729–37.
  5. Wang EA, Rosen V, D’Alessandro JS, et al. Recombinant human bone morphogenetic protein induces bone formation. Proc Natl Acad Sci U S A 1990; 87:2220–4.[Abstract/Free Full Text]
  6. Knabbe C, Lippman ME, Wakefield LM, Flanders KC, Kasid A, Derynck R, Dickson RB. Evidence of transforming growth factor-beta is a hormonally regulated negative growth factor in human breast cancer cells. Cell 1987; 48:417–28.[CrossRef][Medline]
  7. Clement JH, Sanger J, Hoffken K. Expression of bone morphogenetic protein 6 in normal mammary tissue and breast cancer cell lines and regulation by epidermal growth factors. Int J Cancer 1999; 80(2):250–6.[CrossRef][Medline]
  8. Schwalbe M, Sanger J, Eggers R, Nauman A, Schmidt A, Hoffken K, Clement JH. Differential expression and regulation of bone morphogenetic protein 7 in breast cancer. Int J Oncol 2003; 23(1):89–95.[Medline]
  9. Arnold SF, Tims E, Mcgrath BE. Identification of bone morphogenetic proteins and their receptors in human breast cancer cells lines: importance of BMP2. Cytokine 1999; 11(12):1031–7.[CrossRef][Medline]
  10. Lacroix M, Siwek B, Marie PJ, Body JJ. Production and regulation of interleukin-11 by breast cancer cells. Cancer Lett. 1998; 127:29–35.[CrossRef][Medline]
  11. Kang Y, Seigel PM, Shu W, et al. A multigenic program mediating breast cancer metastasis to bone. Cancer Cell 2003; 3(6):537–49.[CrossRef][Medline]
  12. Hanavadi S, Martin TA, Mansel RE, Jiang WG. Interleukin-11 and its receptor expression in human breast cancer. Ann Surg Oncol 2006; 13(6):802–8.[Abstract/Free Full Text]
  13. Hanavadi S, Martin TA, Mansel RE, Jiang WG. Bone morphogenic protein (BMP)-15 is reduced by Interleukin-11 in human breast cancer cells. Breast Cancer Res Treat 2004; 88(Suppl 1):S248.
  14. Incerti B, Dong J, Borsani G, Matzuk MM. Structure of the mouse growth differentiation factor 9 gene. Biochim Biophys Acta 1994; 1222:125–8.[Medline]
  15. McGrath SA, Esquela AF, Lee SJ. Oocyte-specific expression of growth differentiation factor-9. Mol Endocrinol 1995; 9:131–6.[Abstract/Free Full Text]
  16. Galea MH, Blamey RW, Elston CE, Ellis IO. The Nottingham prognostic index in primary breast cancer. Breast Cancer Res Treat 1992; 22(3):207–19.[CrossRef][Medline]
  17. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. 1. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology 1991; 19:403–10.[Medline]
  18. Chomczynske P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.[Medline]
  19. Jiang WG, Watkins G, Lane J, Douglas-Jones A, Cunnick GH, Mokbel M, Mansel RE. Prognostic value of Rho family and rho-GDIs in breast cancer. Clin Cancer Res 2003; 9(17):6432–40.[Abstract/Free Full Text]
  20. Davies G, Jiang WG, Mason MD. Cell–cell adhesion and signaling intermediates in human prostate cancer. J Urol 2000; 163:985–92.[CrossRef][Medline]
  21. Aaltonen J, Laitinen MP, Vuojolainen K, et al. Human growth differentiation factor-9 (GDF-9) and its novel homolog GDF-9b are expressed in oocyte during early folliculogenesis. J Clin Endocrinol Metab 1999; 84:2744–50.[Abstract/Free Full Text]
  22. Erickson GF, Shimasaki S. The role of oocyte in folliculogenesis. Trends Endocrinol Metab 2000; 11:193–8.[CrossRef][Medline]
  23. Hayashi M, McGee EA, Min G, Klein C, Rose UM, van Duin M, Hsueh AJ. Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology 1999; 140:1236–44.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Genomics ProteomicsHome page
S. M. BOKOBZA, L. YE, H. E. KYNASTON, R. E. MANSEL, and W. G. JIANG
Reduced Expression of BMPR-IB Correlates with Poor Prognosis and Increased Proliferation of Breast Cancer Cells
Cancer Genomics Proteomics, March 1, 2009; 6(2): 101 - 108.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hanavadi, S.
Right arrow Articles by Jiang, W. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS